Starting /dee2/code/volunteer_pipeline.sh SRR3208048 current disk space = 3049103568896 free memory = 1579041516 SRR3208048 SRAfilesize d66729c29b90d35e925d50d0f41d1592 SRR3208048.sra SRR3208048.sra file validated SRR3208048 is single end SRR3208048 is conventional basespace SRR3208048 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208048_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4875 33.0 33.0 33.0 33.0 33.0 2 32.11125 33.0 33.0 33.0 33.0 33.0 3 32.31675 33.0 33.0 33.0 33.0 33.0 4 32.38025 33.0 33.0 33.0 33.0 33.0 5 32.38225 33.0 33.0 33.0 33.0 33.0 6 36.02425 37.0 37.0 37.0 37.0 37.0 7 36.12475 37.0 37.0 37.0 37.0 37.0 8 36.28 37.0 37.0 37.0 37.0 37.0 9 36.26375 37.0 37.0 37.0 37.0 37.0 10-11 36.303625 37.0 37.0 37.0 37.0 37.0 12-13 36.27775 37.0 37.0 37.0 37.0 37.0 14-15 36.2495 37.0 37.0 37.0 37.0 37.0 16-17 36.306 37.0 37.0 37.0 37.0 37.0 18-19 36.312875000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.297250000000005 37.0 37.0 37.0 37.0 37.0 22-23 36.301375 37.0 37.0 37.0 37.0 37.0 24-25 36.276375 37.0 37.0 37.0 37.0 37.0 26-27 36.22525 37.0 37.0 37.0 37.0 37.0 28-29 36.325874999999996 37.0 37.0 37.0 37.0 37.0 30-31 36.245875 37.0 37.0 37.0 37.0 37.0 32-33 36.253375000000005 37.0 37.0 37.0 37.0 37.0 34-35 36.258250000000004 37.0 37.0 37.0 37.0 37.0 36-37 36.194375 37.0 37.0 37.0 37.0 37.0 38-39 36.18325 37.0 37.0 37.0 37.0 37.0 40-41 36.18475 37.0 37.0 37.0 37.0 37.0 42-43 36.234125 37.0 37.0 37.0 37.0 37.0 44-45 36.20675 37.0 37.0 37.0 37.0 37.0 46-47 36.237875 37.0 37.0 37.0 37.0 37.0 48-49 36.217124999999996 37.0 37.0 37.0 37.0 37.0 50-51 36.159625000000005 37.0 37.0 37.0 37.0 37.0 52-53 36.207625 37.0 37.0 37.0 37.0 37.0 54-55 36.165125 37.0 37.0 37.0 37.0 37.0 56-57 36.208875 37.0 37.0 37.0 37.0 37.0 58-59 36.160875000000004 37.0 37.0 37.0 37.0 37.0 60-61 36.200375 37.0 37.0 37.0 37.0 37.0 62-63 36.144999999999996 37.0 37.0 37.0 37.0 37.0 64-65 36.117999999999995 37.0 37.0 37.0 37.0 37.0 66-67 36.13275 37.0 37.0 37.0 37.0 37.0 68-69 36.14 37.0 37.0 37.0 37.0 37.0 70-71 36.085125000000005 37.0 37.0 37.0 37.0 37.0 72-73 36.1135 37.0 37.0 37.0 37.0 37.0 74-75 36.002875 37.0 37.0 37.0 37.0 37.0 76-77 36.069 37.0 37.0 37.0 37.0 37.0 78-79 36.12225 37.0 37.0 37.0 37.0 37.0 80-81 36.012625 37.0 37.0 37.0 37.0 37.0 82-83 36.04475 37.0 37.0 37.0 37.0 37.0 84-85 36.048625 37.0 37.0 37.0 37.0 37.0 86-87 35.99325 37.0 37.0 37.0 37.0 37.0 88-89 35.927125000000004 37.0 37.0 37.0 37.0 37.0 90-91 35.96575 37.0 37.0 37.0 37.0 37.0 92-93 35.94875 37.0 37.0 37.0 37.0 37.0 94-95 35.94 37.0 37.0 37.0 37.0 37.0 96-97 35.816375 37.0 37.0 37.0 37.0 37.0 98-99 35.879125 37.0 37.0 37.0 37.0 37.0 100-101 35.787875 37.0 37.0 37.0 37.0 37.0 102-103 35.829 37.0 37.0 37.0 37.0 37.0 104-105 35.848375000000004 37.0 37.0 37.0 37.0 37.0 106-107 35.8615 37.0 37.0 37.0 37.0 37.0 108-109 35.826125000000005 37.0 37.0 37.0 37.0 37.0 110-111 35.738125 37.0 37.0 37.0 37.0 37.0 112-113 35.694 37.0 37.0 37.0 37.0 37.0 114-115 35.77625 37.0 37.0 37.0 37.0 37.0 116-117 35.635374999999996 37.0 37.0 37.0 37.0 37.0 118-119 35.61225 37.0 37.0 37.0 37.0 37.0 120-121 35.613125 37.0 37.0 37.0 37.0 37.0 122-123 35.59975 37.0 37.0 37.0 37.0 37.0 124-125 33.885374999999996 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 3.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 3.0 15 3.0 16 0.0 17 1.0 18 0.0 19 2.0 20 0.0 21 2.0 22 5.0 23 3.0 24 6.0 25 5.0 26 8.0 27 12.0 28 22.0 29 27.0 30 31.0 31 27.0 32 56.0 33 75.0 34 136.0 35 237.0 36 3308.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.179487179487182 17.025641025641026 13.538461538461538 44.256410256410255 2 20.974999999999998 22.075 38.025 18.925 3 22.6 26.125 26.85 24.425 4 24.0 31.874999999999996 21.7 22.425 5 23.7 35.225 22.6 18.475 6 18.525 36.9 25.5 19.075 7 17.7 19.6 41.825 20.875 8 18.575 23.625 30.475 27.325 9 19.575 23.5 32.225 24.7 10-11 22.8875 33.0125 23.0 21.099999999999998 12-13 20.2625 26.8375 30.225 22.675 14-15 21.025 27.1375 28.4 23.4375 16-17 22.35 27.737499999999997 27.3875 22.525000000000002 18-19 22.05 27.8625 27.787499999999998 22.3 20-21 22.675 28.487499999999997 27.437499999999996 21.4 22-23 21.275 27.375 29.075 22.275 24-25 21.625 28.95 26.974999999999998 22.45 26-27 21.637500000000003 27.825 28.462500000000002 22.075 28-29 20.5875 29.4875 28.462500000000002 21.462500000000002 30-31 20.8 28.275 28.199999999999996 22.725 32-33 21.142785696424106 27.081770442610654 29.00725181295324 22.768192048012004 34-35 21.265158144768094 28.42855356919615 27.82847855981998 22.477809726215778 36-37 21.49018627328416 28.42855356919615 27.265908238529818 22.815351918989872 38-39 21.1375 28.712500000000002 28.525 21.625 40-41 21.3625 28.6625 28.275 21.7 42-43 21.775 28.7375 27.462500000000002 22.025 44-45 22.412499999999998 27.8375 28.325 21.425 46-47 22.2625 27.450000000000003 27.5625 22.725 48-49 21.125 27.6125 28.9875 22.275 50-51 22.287499999999998 27.800000000000004 27.85 22.0625 52-53 22.225 29.9375 26.450000000000003 21.3875 54-55 21.9375 28.299999999999997 27.3375 22.425 56-57 22.4625 28.4375 27.125 21.975 58-59 21.525 28.799999999999997 28.0625 21.6125 60-61 22.075 28.249999999999996 26.900000000000002 22.775000000000002 62-63 22.125 28.375 27.85 21.65 64-65 22.4875 28.025 27.400000000000002 22.0875 66-67 21.925 29.4125 27.35 21.3125 68-69 21.3125 28.9875 27.8125 21.8875 70-71 21.837500000000002 28.9875 27.3375 21.837500000000002 72-73 20.849999999999998 28.6125 28.537499999999998 22.0 74-75 20.974999999999998 28.8875 28.1 22.037499999999998 76-77 22.95 28.1125 26.8 22.1375 78-79 21.675 28.075 27.712500000000002 22.537499999999998 80-81 21.512500000000003 28.4375 28.6375 21.4125 82-83 22.6875 27.625 27.800000000000004 21.8875 84-85 21.575 28.275 28.075 22.075 86-87 21.625 28.4 27.3125 22.662499999999998 88-89 22.625 28.1 27.150000000000002 22.125 90-91 21.925 27.987499999999997 27.237499999999997 22.85 92-93 21.45 28.712500000000002 28.4125 21.425 94-95 23.025000000000002 27.762500000000003 27.6625 21.55 96-97 21.637500000000003 28.237499999999997 29.025000000000002 21.099999999999998 98-99 22.1 26.825 28.025 23.05 100-101 22.55 28.3125 27.975 21.1625 102-103 22.2 28.749999999999996 27.175 21.875 104-105 21.5375 29.099999999999998 27.0625 22.3 106-107 22.925 28.199999999999996 27.5875 21.2875 108-109 21.975 28.4375 27.775 21.8125 110-111 23.0375 28.749999999999996 25.887500000000003 22.325 112-113 22.787499999999998 29.849999999999998 26.0125 21.349999999999998 114-115 22.75 28.799999999999997 26.737499999999997 21.712500000000002 116-117 23.1625 29.475 26.05 21.3125 118-119 23.2375 28.962500000000002 26.387500000000003 21.4125 120-121 22.8125 29.049999999999997 26.237500000000004 21.9 122-123 23.3125 28.8625 26.0 21.825 124-125 23.674999999999997 28.8625 24.8125 22.650000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.5 19 2.0 20 2.0 21 2.5 22 2.0 23 4.0 24 5.5 25 7.5 26 9.5 27 10.5 28 12.5 29 20.0 30 30.0 31 34.5 32 43.0 33 51.5 34 65.5 35 78.5 36 91.0 37 110.0 38 131.5 39 170.5 40 193.5 41 201.0 42 233.0 43 252.0 44 242.5 45 254.5 46 242.5 47 212.0 48 219.5 49 210.5 50 163.0 51 133.5 52 111.0 53 85.0 54 67.5 55 54.0 56 46.0 57 30.5 58 24.5 59 23.5 60 21.5 61 18.5 62 13.5 63 12.0 64 10.5 65 6.0 66 2.5 67 1.5 68 2.5 69 3.5 70 3.5 71 2.5 72 2.0 73 1.5 74 1.0 75 1.0 76 2.0 77 3.0 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.025 34-35 0.0125 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0125 0.0 0.0 0.0 50-51 0.0875 0.025 0.0 0.0 0.0 52-53 0.125 0.025 0.0 0.0 0.0 54-55 0.125 0.025 0.0 0.0 0.0 56-57 0.125 0.025 0.0 0.0 0.0 58-59 0.15 0.025 0.0 0.0 0.0 60-61 0.175 0.025 0.0 0.0 0.0 62-63 0.175 0.025 0.0 0.0 0.0 64-65 0.1875 0.025 0.0 0.0 0.0 66-67 0.225 0.025 0.0 0.0 0.0 68-69 0.2375 0.025 0.0 0.0 0.0 70-71 0.25 0.025 0.0 0.0 0.0 72-73 0.25 0.025 0.0 0.0 0.0 74-75 0.30000000000000004 0.025 0.0 0.0 0.0 76-77 0.375 0.025 0.0 0.0 0.0 78-79 0.4 0.025 0.0 0.0 0.0 80-81 0.475 0.025 0.0 0.0 0.0 82-83 0.475 0.025 0.0 0.0 0.0 84-85 0.575 0.025 0.0 0.0 0.0 86-87 0.6499999999999999 0.025 0.0 0.0 0.0 88-89 0.7875 0.025 0.0 0.0 0.0 90-91 0.9 0.025 0.0 0.0 0.0 92-93 1.1 0.025 0.0 0.0 0.0 94-95 1.5125 0.025 0.0 0.0 0.0 96-97 1.925 0.025 0.0 0.0 0.0 98-99 2.375 0.025 0.0 0.0 0.0 100-101 2.875 0.025 0.0 0.0 0.0 102-103 3.6625 0.025 0.0 0.0 0.0 104-105 4.4 0.025 0.0 0.0 0.0 106-107 5.125 0.025 0.0 0.0 0.0 108-109 6.0375 0.025 0.0 0.0 0.0 110-111 7.2625 0.025 0.0 0.0 0.0 112-113 8.4625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra Read 1036127 spots for SRR3208048.sra Written 1036127 spots for SRR3208048.sra Read 1036115 spots for SRR3208048.sra Written 1036115 spots for SRR3208048.sra SRR ids: ['SRR3208048.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c2y7ogsy SRR3208048.sra spots: 20722312 blocks: [[1, 1036115], [1036116, 2072230], [2072231, 3108345], [3108346, 4144460], [4144461, 5180575], [5180576, 6216690], [6216691, 7252805], [7252806, 8288920], [8288921, 9325035], [9325036, 10361150], [10361151, 11397265], [11397266, 12433380], [12433381, 13469495], [13469496, 14505610], [14505611, 15541725], [15541726, 16577840], [16577841, 17613955], [17613956, 18650070], [18650071, 19686185], [19686186, 20722312]] SRR3208048 file size 6636814 SRR3208048 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208048 SRR3208048_1.fastq Input file: SRR3208048_1.fastq trimmed: SRR3208048-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:07:46 2025 >> started Wed Feb 12 04:08:01 2025 >> done (15.265s) 20722312 reads processed; of these: 17635 ( 0.09%) short reads filtered out after trimming by size control 100780 ( 0.49%) empty reads filtered out after trimming by size control 20603897 (99.43%) reads available; of these: 2446396 (11.87%) trimmed reads available after processing 18157501 (88.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 686 0.00% 19 663 0.00% 20 764 0.00% 21 820 0.00% 22 890 0.00% 23 982 0.00% 24 1184 0.01% 25 1300 0.01% 26 1251 0.01% 27 1228 0.01% 28 1248 0.01% 29 1404 0.01% 30 2007 0.01% 31 2044 0.01% 32 1202 0.01% 33 1191 0.01% 34 1153 0.01% 35 1278 0.01% 36 1214 0.01% 37 1263 0.01% 38 1256 0.01% 39 1273 0.01% 40 1284 0.01% 41 1308 0.01% 42 1306 0.01% 43 1311 0.01% 44 1432 0.01% 45 1373 0.01% 46 1407 0.01% 47 1447 0.01% 48 1482 0.01% 49 1617 0.01% 50 1568 0.01% 51 1637 0.01% 52 1636 0.01% 53 1564 0.01% 54 1679 0.01% 55 1690 0.01% 56 1740 0.01% 57 1857 0.01% 58 1949 0.01% 59 2097 0.01% 60 2217 0.01% 61 2132 0.01% 62 2276 0.01% 63 2327 0.01% 64 2298 0.01% 65 2422 0.01% 66 2479 0.01% 67 2696 0.01% 68 2901 0.01% 69 3202 0.02% 70 3388 0.02% 71 3810 0.02% 72 3904 0.02% 73 4187 0.02% 74 4535 0.02% 75 4653 0.02% 76 4878 0.02% 77 5376 0.03% 78 5982 0.03% 79 6645 0.03% 80 7619 0.04% 81 8480 0.04% 82 9620 0.05% 83 10800 0.05% 84 11533 0.06% 85 12571 0.06% 86 13791 0.07% 87 14993 0.07% 88 16980 0.08% 89 19397 0.09% 90 21925 0.11% 91 24720 0.12% 92 27980 0.14% 93 30891 0.15% 94 3299 0.02% 95 3367 0.02% 96 3508 0.02% 97 3904 0.02% 98 3950 0.02% 99 4155 0.02% 100 4519 0.02% 101 4510 0.02% 102 4892 0.02% 103 5019 0.02% 104 5368 0.03% 105 5690 0.03% 106 6089 0.03% 107 6697 0.03% 108 7460 0.04% 109 8025 0.04% 110 8608 0.04% 111 9739 0.05% 112 10735 0.05% 113 12431 0.06% 114 13930 0.07% 115 16132 0.08% 116 18628 0.09% 117 22789 0.11% 118 28107 0.14% 119 37608 0.18% 120 49367 0.24% 121 67247 0.33% 122 117631 0.57% 123 322521 1.57% 124 1269178 6.16% 125 18157501 88.13% 20603897 reads passed initial QC criterion=sequence-density sequence-density=6.15 sequence-density-rank=1 fanout-score=50.71 fanout-score-rank=1 prefix-density=8.04 prefix-fanout=38.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC criterion=fanout-score sequence-density=6.15 sequence-density-rank=1 fanout-score=50.71 fanout-score-rank=1 prefix-density=8.04 prefix-fanout=38.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC -o SRR3208048 - Input file: STDIN trimmed: SRR3208048-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:08:52 2025 >> started Wed Feb 12 04:09:14 2025 >> done (21.736s) 14717069 reads processed; of these: 128 ( 0.00%) short reads filtered out after trimming by size control 724 ( 0.00%) empty reads filtered out after trimming by size control 14716217 (99.99%) reads available; of these: 2346539 (15.95%) trimmed reads available after processing 12369678 (84.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 493 0.00% 19 500 0.00% 20 537 0.00% 21 574 0.00% 22 639 0.00% 23 719 0.00% 24 854 0.01% 25 906 0.01% 26 873 0.01% 27 868 0.01% 28 903 0.01% 29 984 0.01% 30 1439 0.01% 31 1451 0.01% 32 844 0.01% 33 857 0.01% 34 808 0.01% 35 915 0.01% 36 867 0.01% 37 944 0.01% 38 889 0.01% 39 906 0.01% 40 919 0.01% 41 938 0.01% 42 952 0.01% 43 921 0.01% 44 1005 0.01% 45 965 0.01% 46 1026 0.01% 47 1006 0.01% 48 1070 0.01% 49 1180 0.01% 50 1138 0.01% 51 1194 0.01% 52 1142 0.01% 53 1121 0.01% 54 1199 0.01% 55 1240 0.01% 56 1239 0.01% 57 1299 0.01% 58 1392 0.01% 59 1512 0.01% 60 1588 0.01% 61 1513 0.01% 62 1614 0.01% 63 1673 0.01% 64 1645 0.01% 65 1748 0.01% 66 1790 0.01% 67 1921 0.01% 68 2077 0.01% 69 2295 0.02% 70 2420 0.02% 71 2677 0.02% 72 2704 0.02% 73 2797 0.02% 74 3019 0.02% 75 3230 0.02% 76 3521 0.02% 77 3888 0.03% 78 4338 0.03% 79 4819 0.03% 80 5419 0.04% 81 6141 0.04% 82 6883 0.05% 83 7748 0.05% 84 8262 0.06% 85 9034 0.06% 86 9869 0.07% 87 10916 0.07% 88 12142 0.08% 89 14011 0.10% 90 15557 0.11% 91 17417 0.12% 92 19692 0.13% 93 22449 0.15% 94 24844 0.17% 95 27112 0.18% 96 28600 0.19% 97 31083 0.21% 98 33767 0.23% 99 37352 0.25% 100 41301 0.28% 101 45662 0.31% 102 50447 0.34% 103 55619 0.38% 104 59229 0.40% 105 62865 0.43% 106 64750 0.44% 107 68039 0.46% 108 71674 0.49% 109 75641 0.51% 110 80715 0.55% 111 87079 0.59% 112 94405 0.64% 113 100250 0.68% 114 105253 0.72% 115 109713 0.75% 116 112886 0.77% 117 116486 0.79% 118 120832 0.82% 119 132628 0.90% 120 159506 1.08% 121 221433 1.50% 122 443835 3.02% 123 200145 1.36% 124 794590 5.40% 125 10800431 73.39% criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=4.55 fanout-score-rank=18 prefix-density=0.11 prefix-fanout=3.1 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=255.77 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=25.1 sequence=AAGAAGAAGAAA Started job on | Feb 12 04:09:43 Started mapping on | Feb 12 04:09:44 Finished on | Feb 12 04:10:39 Mapping speed, Million of reads per hour | 1348.56 Number of input reads | 20603045 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 17789513 Uniquely mapped reads % | 86.34% Average mapped length | 121.82 Number of splices: Total | 6713880 Number of splices: Annotated (sjdb) | 6586565 Number of splices: GT/AG | 6608107 Number of splices: GC/AG | 87080 Number of splices: AT/AC | 6423 Number of splices: Non-canonical | 12270 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428766 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 725623 % of reads mapped to too many loci | 3.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.98% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2384766 2384766 2384766 N_multimapping 428766 428766 428766 N_noFeature 755959 9214257 9208302 N_ambiguous 191100 34285 34313 UnstrandedReadsAssigned:16842454 PositiveStrandReadsAssigned:8540971 NegativeStrandReadsAssigned:8546898 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=123 echo kmer=119 SRR3208048 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208048-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,603,045 reads, 17,857,685 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR3208048.ke.tsv 34699 SRR3208048.se.tsv 87100 total ==> SRR3208048.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 465 18.2029 Potri.005G024800.1.v4.1 1035 936 114 9.14937 Potri.004G059700.1.v4.1 961 862 12 1.04577 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 267.388 7.06275 Potri.016G087400.1.v4.1 270 171 801 351.883 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 76 3.41052 Potri.012G127500.1.v4.1 977 878 2669 228.358 ==> SRR3208048.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1904 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 349 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 52 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 47 SRR3208048 completed mapping pipeline successfully