Starting /dee2/code/volunteer_pipeline.sh SRR3208049 current disk space = 3049098645504 free memory = 1550462616 SRR3208049 SRAfilesize 4af73ffd8766bfd3246377048bca4dc2 SRR3208049.sra SRR3208049.sra file validated SRR3208049 is single end SRR3208049 is conventional basespace SRR3208049 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208049_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.62475 33.0 33.0 33.0 33.0 33.0 2 32.17475 33.0 33.0 33.0 33.0 33.0 3 32.33725 33.0 33.0 33.0 33.0 33.0 4 32.32325 33.0 33.0 33.0 33.0 33.0 5 32.42025 33.0 33.0 33.0 33.0 33.0 6 36.11375 37.0 37.0 37.0 37.0 37.0 7 36.147 37.0 37.0 37.0 37.0 37.0 8 36.291 37.0 37.0 37.0 37.0 37.0 9 36.23675 37.0 37.0 37.0 37.0 37.0 10-11 36.338375 37.0 37.0 37.0 37.0 37.0 12-13 36.3595 37.0 37.0 37.0 37.0 37.0 14-15 36.36225 37.0 37.0 37.0 37.0 37.0 16-17 36.33025 37.0 37.0 37.0 37.0 37.0 18-19 36.317375 37.0 37.0 37.0 37.0 37.0 20-21 36.3525 37.0 37.0 37.0 37.0 37.0 22-23 36.326125000000005 37.0 37.0 37.0 37.0 37.0 24-25 36.311875 37.0 37.0 37.0 37.0 37.0 26-27 36.17525 37.0 37.0 37.0 37.0 37.0 28-29 36.2665 37.0 37.0 37.0 37.0 37.0 30-31 36.288125 37.0 37.0 37.0 37.0 37.0 32-33 36.279375 37.0 37.0 37.0 37.0 37.0 34-35 36.283875 37.0 37.0 37.0 37.0 37.0 36-37 36.27675 37.0 37.0 37.0 37.0 37.0 38-39 36.31462500000001 37.0 37.0 37.0 37.0 37.0 40-41 36.25575 37.0 37.0 37.0 37.0 37.0 42-43 36.287499999999994 37.0 37.0 37.0 37.0 37.0 44-45 36.219375 37.0 37.0 37.0 37.0 37.0 46-47 36.261875 37.0 37.0 37.0 37.0 37.0 48-49 36.236999999999995 37.0 37.0 37.0 37.0 37.0 50-51 36.240625 37.0 37.0 37.0 37.0 37.0 52-53 36.213375 37.0 37.0 37.0 37.0 37.0 54-55 36.264624999999995 37.0 37.0 37.0 37.0 37.0 56-57 36.2115 37.0 37.0 37.0 37.0 37.0 58-59 36.191625 37.0 37.0 37.0 37.0 37.0 60-61 36.226749999999996 37.0 37.0 37.0 37.0 37.0 62-63 36.179125 37.0 37.0 37.0 37.0 37.0 64-65 36.141375 37.0 37.0 37.0 37.0 37.0 66-67 36.144875 37.0 37.0 37.0 37.0 37.0 68-69 36.179500000000004 37.0 37.0 37.0 37.0 37.0 70-71 36.172 37.0 37.0 37.0 37.0 37.0 72-73 36.101625 37.0 37.0 37.0 37.0 37.0 74-75 35.977625 37.0 37.0 37.0 37.0 37.0 76-77 36.022999999999996 37.0 37.0 37.0 37.0 37.0 78-79 36.020375 37.0 37.0 37.0 37.0 37.0 80-81 36.01725 37.0 37.0 37.0 37.0 37.0 82-83 35.968875 37.0 37.0 37.0 37.0 37.0 84-85 36.0125 37.0 37.0 37.0 37.0 37.0 86-87 35.94375 37.0 37.0 37.0 37.0 37.0 88-89 35.929375 37.0 37.0 37.0 37.0 37.0 90-91 35.94475 37.0 37.0 37.0 37.0 37.0 92-93 35.925625 37.0 37.0 37.0 37.0 37.0 94-95 35.88525 37.0 37.0 37.0 37.0 37.0 96-97 35.831 37.0 37.0 37.0 37.0 37.0 98-99 35.868125000000006 37.0 37.0 37.0 37.0 37.0 100-101 35.7655 37.0 37.0 37.0 37.0 37.0 102-103 35.775125 37.0 37.0 37.0 37.0 37.0 104-105 35.746625 37.0 37.0 37.0 37.0 37.0 106-107 35.766875 37.0 37.0 37.0 37.0 37.0 108-109 35.713499999999996 37.0 37.0 37.0 37.0 37.0 110-111 35.687875 37.0 37.0 37.0 37.0 37.0 112-113 35.6555 37.0 37.0 37.0 37.0 37.0 114-115 35.679 37.0 37.0 37.0 37.0 37.0 116-117 35.623625 37.0 37.0 37.0 37.0 37.0 118-119 35.649875 37.0 37.0 37.0 37.0 37.0 120-121 35.504000000000005 37.0 37.0 37.0 37.0 37.0 122-123 35.458375000000004 37.0 37.0 37.0 37.0 37.0 124-125 33.629125 37.0 35.0 37.0 19.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 3.0 19 2.0 20 2.0 21 8.0 22 9.0 23 4.0 24 7.0 25 9.0 26 5.0 27 14.0 28 11.0 29 20.0 30 27.0 31 49.0 32 58.0 33 62.0 34 116.0 35 223.0 36 3339.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.211336240061556 15.542446781225955 13.413695819440882 46.83252115927161 2 20.724999999999998 21.75 37.625 19.900000000000002 3 22.35 23.95 28.599999999999998 25.1 4 23.974999999999998 32.025 20.1 23.9 5 25.525 34.35 22.75 17.375 6 19.7 36.575 23.724999999999998 20.0 7 16.775000000000002 21.2 41.55 20.474999999999998 8 18.95 25.7 29.875 25.474999999999998 9 19.650000000000002 24.65 31.874999999999996 23.825 10-11 22.900000000000002 32.7875 22.9375 21.375 12-13 20.125 27.150000000000002 29.6625 23.0625 14-15 20.6875 28.1 28.65 22.5625 16-17 21.9625 27.150000000000002 28.199999999999996 22.6875 18-19 21.925 28.7375 26.724999999999998 22.6125 20-21 22.225 28.175 27.5875 22.0125 22-23 21.375 28.5875 27.6625 22.375 24-25 21.6625 28.012500000000003 27.85 22.475 26-27 21.627703462932867 27.84098012251531 28.20352544068008 22.327790973871732 28-29 22.22777847230904 28.091011376422053 27.078384798099762 22.602825353169145 30-31 21.780445111277817 27.86946736684171 27.394348587146787 22.95573893473368 32-33 21.117779444861213 28.91972993248312 27.53188297074269 22.43060765191298 34-35 21.980495123780948 28.91972993248312 27.169292323080768 21.930482620655166 36-37 20.790098762345295 28.778597324665583 28.653581697712216 21.77772221527691 38-39 21.3 28.8375 28.15 21.712500000000002 40-41 21.5 29.349999999999998 27.187499999999996 21.9625 42-43 21.4375 28.225 27.325 23.0125 44-45 22.525000000000002 27.775 28.050000000000004 21.65 46-47 22.912499999999998 28.3375 26.7625 21.987499999999997 48-49 22.1375 28.075 27.962500000000002 21.825 50-51 21.625 28.5875 28.3125 21.475 52-53 22.0875 28.537499999999998 27.175 22.2 54-55 20.962500000000002 28.237499999999997 28.050000000000004 22.75 56-57 22.3375 27.825 27.775 22.0625 58-59 22.05 28.512500000000003 28.012500000000003 21.425 60-61 22.0125 27.8375 27.425 22.725 62-63 21.9625 28.237499999999997 27.875 21.925 64-65 22.0 28.675 27.3375 21.987499999999997 66-67 21.925 28.15 27.150000000000002 22.775000000000002 68-69 22.05 28.475 27.762500000000003 21.712500000000002 70-71 21.85 28.5625 27.6125 21.975 72-73 22.35 28.075 27.6875 21.8875 74-75 21.475 29.325000000000003 28.1375 21.0625 76-77 22.5 28.262500000000003 28.349999999999998 20.8875 78-79 21.637500000000003 28.499999999999996 27.987499999999997 21.875 80-81 22.1375 27.3 28.812500000000004 21.75 82-83 21.837500000000002 28.487499999999997 27.250000000000004 22.425 84-85 22.15 28.7375 26.825 22.287499999999998 86-87 23.275000000000002 27.675 27.500000000000004 21.55 88-89 22.1 28.512500000000003 27.5125 21.875 90-91 21.525 28.075 28.037499999999998 22.3625 92-93 21.9 28.875 28.1625 21.0625 94-95 22.3 28.262500000000003 27.200000000000003 22.237499999999997 96-97 21.349999999999998 27.9375 29.225 21.4875 98-99 22.3875 28.275 27.450000000000003 21.8875 100-101 22.3625 27.987499999999997 27.925 21.725 102-103 22.5625 27.800000000000004 28.262500000000003 21.375 104-105 22.55 27.537499999999998 28.012500000000003 21.9 106-107 22.6125 29.15 27.0875 21.15 108-109 22.3 27.375 27.9125 22.412499999999998 110-111 22.975 28.925 27.1125 20.9875 112-113 22.5625 27.9375 28.175 21.325 114-115 21.9375 28.799999999999997 27.575 21.6875 116-117 22.9875 27.9125 27.0875 22.0125 118-119 23.4625 29.212500000000002 26.400000000000002 20.925 120-121 23.1125 29.512500000000003 25.137500000000003 22.237499999999997 122-123 23.674999999999997 29.175 25.7125 21.4375 124-125 23.6375 29.549999999999997 25.624999999999996 21.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 3.0 25 4.0 26 2.0 27 3.5 28 8.5 29 15.0 30 22.5 31 23.5 32 35.0 33 54.5 34 64.0 35 79.0 36 97.5 37 117.0 38 131.0 39 151.5 40 190.5 41 231.0 42 255.5 43 273.0 44 279.0 45 254.5 46 239.0 47 238.0 48 230.5 49 196.5 50 155.0 51 130.5 52 106.0 53 89.0 54 70.0 55 42.5 56 29.5 57 31.0 58 28.5 59 21.5 60 14.5 61 11.5 62 12.5 63 11.0 64 8.5 65 7.0 66 5.5 67 6.0 68 5.5 69 3.5 70 1.5 71 0.5 72 3.0 73 3.5 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0125 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77381251570746 99.25 2 0.20105554159336514 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025131942699170642 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 14 0.35000000000000003 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.7125 0.0 0.0 0.0 0.0 110-111 3.5875 0.0 0.0 0.0 0.0 112-113 4.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991960 spots for SRR3208049.sra Written 991960 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra Read 991958 spots for SRR3208049.sra Written 991958 spots for SRR3208049.sra SRR ids: ['SRR3208049.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ykomhd7b SRR3208049.sra spots: 19839162 blocks: [[1, 991958], [991959, 1983916], [1983917, 2975874], [2975875, 3967832], [3967833, 4959790], [4959791, 5951748], [5951749, 6943706], [6943707, 7935664], [7935665, 8927622], [8927623, 9919580], [9919581, 10911538], [10911539, 11903496], [11903497, 12895454], [12895455, 13887412], [13887413, 14879370], [14879371, 15871328], [15871329, 16863286], [16863287, 17855244], [17855245, 18847202], [18847203, 19839162]] SRR3208049 file size 6353495 SRR3208049 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208049 SRR3208049_1.fastq Input file: SRR3208049_1.fastq trimmed: SRR3208049-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:07:45 2025 >> started Wed Feb 12 04:08:02 2025 >> done (16.944s) 19839162 reads processed; of these: 14929 ( 0.08%) short reads filtered out after trimming by size control 102775 ( 0.52%) empty reads filtered out after trimming by size control 19721458 (99.41%) reads available; of these: 2214974 (11.23%) trimmed reads available after processing 17506484 (88.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 580 0.00% 19 640 0.00% 20 612 0.00% 21 693 0.00% 22 778 0.00% 23 841 0.00% 24 1070 0.01% 25 1136 0.01% 26 1143 0.01% 27 1064 0.01% 28 1079 0.01% 29 1212 0.01% 30 1673 0.01% 31 1549 0.01% 32 1130 0.01% 33 940 0.00% 34 1032 0.01% 35 983 0.00% 36 1074 0.01% 37 1056 0.01% 38 1046 0.01% 39 1078 0.01% 40 1068 0.01% 41 1069 0.01% 42 1164 0.01% 43 1200 0.01% 44 1191 0.01% 45 1183 0.01% 46 1163 0.01% 47 1211 0.01% 48 1179 0.01% 49 1186 0.01% 50 1357 0.01% 51 1403 0.01% 52 1398 0.01% 53 1338 0.01% 54 1343 0.01% 55 1429 0.01% 56 1476 0.01% 57 1527 0.01% 58 1565 0.01% 59 1652 0.01% 60 1691 0.01% 61 1614 0.01% 62 1737 0.01% 63 2083 0.01% 64 1885 0.01% 65 1834 0.01% 66 1939 0.01% 67 1962 0.01% 68 2170 0.01% 69 2156 0.01% 70 2391 0.01% 71 2454 0.01% 72 2887 0.01% 73 3379 0.02% 74 3479 0.02% 75 3292 0.02% 76 3187 0.02% 77 3196 0.02% 78 3433 0.02% 79 3833 0.02% 80 4304 0.02% 81 4741 0.02% 82 5291 0.03% 83 5734 0.03% 84 6251 0.03% 85 6471 0.03% 86 7227 0.04% 87 7857 0.04% 88 8842 0.04% 89 9996 0.05% 90 11426 0.06% 91 13135 0.07% 92 14833 0.08% 93 16747 0.08% 94 3051 0.02% 95 3192 0.02% 96 3402 0.02% 97 3647 0.02% 98 3765 0.02% 99 3837 0.02% 100 4097 0.02% 101 4201 0.02% 102 4407 0.02% 103 4540 0.02% 104 5003 0.03% 105 5338 0.03% 106 5692 0.03% 107 6206 0.03% 108 6838 0.03% 109 7523 0.04% 110 8101 0.04% 111 9123 0.05% 112 10430 0.05% 113 11479 0.06% 114 13399 0.07% 115 15236 0.08% 116 17775 0.09% 117 21479 0.11% 118 26961 0.14% 119 35960 0.18% 120 46192 0.23% 121 64675 0.33% 122 112003 0.57% 123 308301 1.56% 124 1217153 6.17% 125 17506484 88.77% 19721458 reads passed initial QC criterion=sequence-density sequence-density=4.04 sequence-density-rank=1 fanout-score=53.12 fanout-score-rank=1 prefix-density=5.51 prefix-fanout=38.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=4.04 sequence-density-rank=1 fanout-score=53.12 fanout-score-rank=1 prefix-density=5.51 prefix-fanout=38.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208049 - Input file: STDIN trimmed: SRR3208049-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:08:52 2025 >> started Wed Feb 12 04:09:10 2025 >> done (17.470s) 11832875 reads processed; of these: 152 ( 0.00%) short reads filtered out after trimming by size control 1979 ( 0.02%) empty reads filtered out after trimming by size control 11830744 (99.98%) reads available; of these: 1487742 (12.58%) trimmed reads available after processing 10343002 (87.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 375 0.00% 19 385 0.00% 20 379 0.00% 21 423 0.00% 22 480 0.00% 23 518 0.00% 24 636 0.01% 25 690 0.01% 26 721 0.01% 27 642 0.01% 28 669 0.01% 29 739 0.01% 30 1001 0.01% 31 906 0.01% 32 657 0.01% 33 537 0.00% 34 631 0.01% 35 593 0.01% 36 655 0.01% 37 620 0.01% 38 652 0.01% 39 651 0.01% 40 624 0.01% 41 650 0.01% 42 707 0.01% 43 735 0.01% 44 693 0.01% 45 709 0.01% 46 699 0.01% 47 724 0.01% 48 714 0.01% 49 689 0.01% 50 811 0.01% 51 827 0.01% 52 882 0.01% 53 803 0.01% 54 784 0.01% 55 813 0.01% 56 915 0.01% 57 931 0.01% 58 944 0.01% 59 1008 0.01% 60 1014 0.01% 61 969 0.01% 62 997 0.01% 63 1092 0.01% 64 1138 0.01% 65 1105 0.01% 66 1146 0.01% 67 1165 0.01% 68 1292 0.01% 69 1322 0.01% 70 1401 0.01% 71 1410 0.01% 72 1531 0.01% 73 1588 0.01% 74 1600 0.01% 75 1777 0.02% 76 1846 0.02% 77 1926 0.02% 78 2126 0.02% 79 2311 0.02% 80 2648 0.02% 81 2857 0.02% 82 3166 0.03% 83 3449 0.03% 84 3712 0.03% 85 3900 0.03% 86 4434 0.04% 87 4817 0.04% 88 5257 0.04% 89 6046 0.05% 90 6842 0.06% 91 7704 0.07% 92 8721 0.07% 93 10129 0.09% 94 11323 0.10% 95 12283 0.10% 96 13198 0.11% 97 14355 0.12% 98 16159 0.14% 99 17973 0.15% 100 20596 0.17% 101 23135 0.20% 102 26014 0.22% 103 29088 0.25% 104 31646 0.27% 105 34181 0.29% 106 35736 0.30% 107 37939 0.32% 108 40613 0.34% 109 43970 0.37% 110 48282 0.41% 111 53228 0.45% 112 58818 0.50% 113 63396 0.54% 114 68414 0.58% 115 72059 0.61% 116 75425 0.64% 117 78439 0.66% 118 83498 0.71% 119 92525 0.78% 120 116287 0.98% 121 169693 1.43% 122 357490 3.02% 123 166003 1.40% 124 660916 5.59% 125 9126402 77.14% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=4.49 fanout-score-rank=24 prefix-density=0.11 prefix-fanout=3.0 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=5 fanout-score=201.38 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=22.7 sequence=AAGAAGAAGAAA Started job on | Feb 12 04:09:40 Started mapping on | Feb 12 04:09:40 Finished on | Feb 12 04:10:15 Mapping speed, Million of reads per hour | 2028.27 Number of input reads | 19719327 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 18054805 Uniquely mapped reads % | 91.56% Average mapped length | 122.69 Number of splices: Total | 6705740 Number of splices: Annotated (sjdb) | 6572760 Number of splices: GT/AG | 6599772 Number of splices: GC/AG | 86813 Number of splices: AT/AC | 6693 Number of splices: Non-canonical | 12462 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405466 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 607028 % of reads mapped to too many loci | 3.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1259056 1259056 1259056 N_multimapping 405466 405466 405466 N_noFeature 802220 9347309 9373096 N_ambiguous 206258 34361 35716 UnstrandedReadsAssigned:17046327 PositiveStrandReadsAssigned:8673135 NegativeStrandReadsAssigned:8645993 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208049 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208049-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,719,327 reads, 17,931,268 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52401 SRR3208049.ke.tsv 34699 SRR3208049.se.tsv 87100 total ==> SRR3208049.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 479 18.7589 Potri.005G024800.1.v4.1 1035 936 101 8.10948 Potri.004G059700.1.v4.1 961 862 13 1.1334 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 285.306 7.53927 Potri.016G087400.1.v4.1 270 171 731 321.269 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 71.5916 3.21406 Potri.012G127500.1.v4.1 977 878 2651 226.915 ==> SRR3208049.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2199 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 390 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 56 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 47 SRR3208049 completed mapping pipeline successfully