Starting /dee2/code/volunteer_pipeline.sh SRR3208050 current disk space = 3049138184192 free memory = 1300157856 SRR3208050 SRAfilesize 5f5796ec5cc03ef5e222c2b46eb2b7fe SRR3208050.sra SRR3208050.sra file validated SRR3208050 is single end SRR3208050 is conventional basespace SRR3208050 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208050_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3985 33.0 33.0 33.0 33.0 33.0 2 32.17125 33.0 33.0 33.0 33.0 33.0 3 32.2905 33.0 33.0 33.0 33.0 33.0 4 32.39475 33.0 33.0 33.0 33.0 33.0 5 32.368 33.0 33.0 33.0 33.0 33.0 6 36.13825 37.0 37.0 37.0 37.0 37.0 7 36.28125 37.0 37.0 37.0 37.0 37.0 8 36.31625 37.0 37.0 37.0 37.0 37.0 9 36.36875 37.0 37.0 37.0 37.0 37.0 10-11 36.33625 37.0 37.0 37.0 37.0 37.0 12-13 36.330124999999995 37.0 37.0 37.0 37.0 37.0 14-15 36.322500000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.350750000000005 37.0 37.0 37.0 37.0 37.0 18-19 36.304375 37.0 37.0 37.0 37.0 37.0 20-21 36.321375 37.0 37.0 37.0 37.0 37.0 22-23 36.332750000000004 37.0 37.0 37.0 37.0 37.0 24-25 36.316 37.0 37.0 37.0 37.0 37.0 26-27 36.199 37.0 37.0 37.0 37.0 37.0 28-29 36.338625 37.0 37.0 37.0 37.0 37.0 30-31 36.2895 37.0 37.0 37.0 37.0 37.0 32-33 36.322375 37.0 37.0 37.0 37.0 37.0 34-35 36.262874999999994 37.0 37.0 37.0 37.0 37.0 36-37 36.269875 37.0 37.0 37.0 37.0 37.0 38-39 36.24625 37.0 37.0 37.0 37.0 37.0 40-41 36.237125 37.0 37.0 37.0 37.0 37.0 42-43 36.297375 37.0 37.0 37.0 37.0 37.0 44-45 36.35175 37.0 37.0 37.0 37.0 37.0 46-47 36.246875 37.0 37.0 37.0 37.0 37.0 48-49 36.235 37.0 37.0 37.0 37.0 37.0 50-51 36.303125 37.0 37.0 37.0 37.0 37.0 52-53 36.257374999999996 37.0 37.0 37.0 37.0 37.0 54-55 36.260625000000005 37.0 37.0 37.0 37.0 37.0 56-57 36.277 37.0 37.0 37.0 37.0 37.0 58-59 36.236875 37.0 37.0 37.0 37.0 37.0 60-61 36.217625 37.0 37.0 37.0 37.0 37.0 62-63 36.181875 37.0 37.0 37.0 37.0 37.0 64-65 36.1965 37.0 37.0 37.0 37.0 37.0 66-67 36.1465 37.0 37.0 37.0 37.0 37.0 68-69 36.17375 37.0 37.0 37.0 37.0 37.0 70-71 36.176874999999995 37.0 37.0 37.0 37.0 37.0 72-73 36.13275 37.0 37.0 37.0 37.0 37.0 74-75 36.112625 37.0 37.0 37.0 37.0 37.0 76-77 36.074875000000006 37.0 37.0 37.0 37.0 37.0 78-79 36.096500000000006 37.0 37.0 37.0 37.0 37.0 80-81 36.08725 37.0 37.0 37.0 37.0 37.0 82-83 36.088375 37.0 37.0 37.0 37.0 37.0 84-85 36.100625 37.0 37.0 37.0 37.0 37.0 86-87 36.091375 37.0 37.0 37.0 37.0 37.0 88-89 36.079750000000004 37.0 37.0 37.0 37.0 37.0 90-91 35.958124999999995 37.0 37.0 37.0 37.0 37.0 92-93 36.001000000000005 37.0 37.0 37.0 37.0 37.0 94-95 35.955 37.0 37.0 37.0 37.0 37.0 96-97 35.916624999999996 37.0 37.0 37.0 37.0 37.0 98-99 35.921375 37.0 37.0 37.0 37.0 37.0 100-101 35.849625 37.0 37.0 37.0 37.0 37.0 102-103 35.82 37.0 37.0 37.0 37.0 37.0 104-105 35.82925 37.0 37.0 37.0 37.0 37.0 106-107 35.874375 37.0 37.0 37.0 37.0 37.0 108-109 35.807500000000005 37.0 37.0 37.0 37.0 37.0 110-111 35.816625 37.0 37.0 37.0 37.0 37.0 112-113 35.647625 37.0 37.0 37.0 37.0 37.0 114-115 35.794875000000005 37.0 37.0 37.0 37.0 37.0 116-117 35.640125 37.0 37.0 37.0 37.0 37.0 118-119 35.68825 37.0 37.0 37.0 37.0 37.0 120-121 35.556124999999994 37.0 37.0 37.0 37.0 37.0 122-123 35.480625 37.0 37.0 37.0 37.0 37.0 124-125 33.886375 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 3.0 19 1.0 20 0.0 21 4.0 22 4.0 23 4.0 24 8.0 25 6.0 26 12.0 27 12.0 28 17.0 29 27.0 30 34.0 31 48.0 32 49.0 33 62.0 34 117.0 35 215.0 36 3348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.665893271461716 15.055426656354731 13.121938643980407 48.15674142820314 2 19.125 21.275 39.475 20.125 3 20.225 25.275 28.625 25.874999999999996 4 24.175 30.775000000000002 20.625 24.425 5 25.025 33.375 23.875 17.724999999999998 6 19.0 36.3 25.25 19.45 7 16.925 19.15 43.725 20.200000000000003 8 18.529632408102024 23.755938984746187 30.732683170792697 26.981745436359088 9 19.75 23.65 32.550000000000004 24.05 10-11 22.112499999999997 33.2375 22.8 21.85 12-13 19.900000000000002 26.575 30.7625 22.7625 14-15 21.349999999999998 28.1875 29.1875 21.275 16-17 21.775 28.3875 27.6125 22.225 18-19 21.5625 28.9125 26.8375 22.6875 20-21 22.225 29.062500000000004 26.5125 22.2 22-23 21.712500000000002 29.2375 27.6875 21.3625 24-25 21.837500000000002 28.325 27.675 22.162499999999998 26-27 20.165020627578446 29.278659832479057 28.078509813726715 22.477809726215778 28-29 21.517879469867466 29.294823705926483 27.231807951987996 21.955488872218055 30-31 21.323161580790394 28.08904452226113 28.864432216108053 21.72336168084042 32-33 21.60910910910911 28.866366366366364 27.652652652652655 21.871871871871875 34-35 21.513445903689806 28.317698561601002 28.292682926829265 21.876172607879926 36-37 21.41338336460288 28.292682926829265 28.042526579111943 22.25140712945591 38-39 21.840230028753595 29.541192649081133 27.50343792974122 21.115139392424055 40-41 21.8125 28.7375 28.000000000000004 21.45 42-43 21.540192524065507 28.50356294536817 27.203400425053132 22.75284410551319 44-45 21.8875 27.762500000000003 27.950000000000003 22.400000000000002 46-47 21.55 28.999999999999996 27.975 21.475 48-49 21.9625 28.512500000000003 28.1375 21.3875 50-51 21.525 28.8375 27.6375 22.0 52-53 22.275 28.812500000000004 27.3875 21.525 54-55 22.5875 27.8125 27.3875 22.2125 56-57 21.5625 29.075 28.762500000000003 20.599999999999998 58-59 21.3625 28.3375 28.425 21.875 60-61 22.025 28.262500000000003 27.675 22.037499999999998 62-63 21.1625 28.15 28.825 21.8625 64-65 21.3875 28.7 28.6625 21.25 66-67 21.55 29.025000000000002 26.9125 22.5125 68-69 22.1875 29.325000000000003 27.200000000000003 21.2875 70-71 22.1 29.1125 27.1375 21.65 72-73 21.224999999999998 28.6875 27.425 22.662499999999998 74-75 21.875 27.875 28.3125 21.9375 76-77 21.337500000000002 28.799999999999997 28.287499999999998 21.575 78-79 22.0875 28.449999999999996 27.1375 22.325 80-81 22.0 28.9125 27.0875 22.0 82-83 21.425 28.9875 27.875 21.712500000000002 84-85 21.575 28.349999999999998 27.6375 22.4375 86-87 22.0625 29.0875 27.437499999999996 21.4125 88-89 23.4875 27.5125 27.425 21.575 90-91 21.912499999999998 28.199999999999996 27.5625 22.325 92-93 21.6875 27.6375 29.1125 21.5625 94-95 21.987499999999997 28.475 27.737499999999997 21.8 96-97 22.1 28.125 27.525 22.25 98-99 22.275 28.599999999999998 27.6375 21.4875 100-101 22.400000000000002 27.9125 27.825 21.8625 102-103 22.537499999999998 28.6125 27.9375 20.9125 104-105 22.0125 28.725 27.5125 21.75 106-107 21.625 27.750000000000004 28.4125 22.2125 108-109 21.9 28.449999999999996 27.950000000000003 21.7 110-111 22.425 28.375 27.712500000000002 21.4875 112-113 22.5 28.6125 27.725 21.1625 114-115 22.5 28.9375 26.787499999999998 21.775 116-117 22.2 28.725 27.975 21.099999999999998 118-119 22.5125 28.6375 27.525 21.325 120-121 23.3125 29.775000000000002 25.937500000000004 20.974999999999998 122-123 23.4625 29.062500000000004 25.5125 21.9625 124-125 22.675 29.2 26.4625 21.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 2.5 26 4.5 27 4.0 28 8.5 29 15.5 30 21.0 31 32.0 32 43.0 33 55.5 34 67.0 35 72.5 36 96.5 37 116.0 38 139.5 39 177.0 40 207.0 41 221.5 42 237.5 43 279.5 44 295.0 45 263.5 46 240.5 47 235.0 48 205.5 49 179.0 50 165.0 51 142.0 52 115.5 53 85.5 54 61.0 55 42.0 56 32.0 57 29.0 58 20.5 59 14.5 60 15.0 61 12.5 62 10.0 63 9.0 64 4.5 65 2.0 66 2.0 67 2.0 68 2.0 69 3.0 70 3.0 71 2.0 72 2.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.025 30-31 0.05 32-33 0.1 34-35 0.0625 36-37 0.0625 38-39 0.0125 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8997995991984 99.7 2 0.0250501002004008 0.05 3 0.0501002004008016 0.15 4 0.0250501002004008 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 3.2249999999999996 0.0 0.0 0.0 0.0 112-113 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000271 spots for SRR3208050.sra Written 1000271 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra Read 1000269 spots for SRR3208050.sra Written 1000269 spots for SRR3208050.sra SRR ids: ['SRR3208050.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lyu02fj1 SRR3208050.sra spots: 20005382 blocks: [[1, 1000269], [1000270, 2000538], [2000539, 3000807], [3000808, 4001076], [4001077, 5001345], [5001346, 6001614], [6001615, 7001883], [7001884, 8002152], [8002153, 9002421], [9002422, 10002690], [10002691, 11002959], [11002960, 12003228], [12003229, 13003497], [13003498, 14003766], [14003767, 15004035], [15004036, 16004304], [16004305, 17004573], [17004574, 18004842], [18004843, 19005111], [19005112, 20005382]] SRR3208050 file size 6406827 SRR3208050 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208050 SRR3208050_1.fastq Input file: SRR3208050_1.fastq trimmed: SRR3208050-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:12:53 2025 >> started Wed Feb 12 04:13:04 2025 >> done (10.773s) 20005382 reads processed; of these: 14418 ( 0.07%) short reads filtered out after trimming by size control 67122 ( 0.34%) empty reads filtered out after trimming by size control 19923842 (99.59%) reads available; of these: 2215502 (11.12%) trimmed reads available after processing 17708340 (88.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 657 0.00% 19 669 0.00% 20 710 0.00% 21 709 0.00% 22 786 0.00% 23 878 0.00% 24 1034 0.01% 25 1188 0.01% 26 1142 0.01% 27 1107 0.01% 28 1142 0.01% 29 1227 0.01% 30 1766 0.01% 31 1769 0.01% 32 1094 0.01% 33 1046 0.01% 34 1101 0.01% 35 1092 0.01% 36 1080 0.01% 37 1221 0.01% 38 1145 0.01% 39 1166 0.01% 40 1197 0.01% 41 1205 0.01% 42 1229 0.01% 43 1192 0.01% 44 1258 0.01% 45 1200 0.01% 46 1295 0.01% 47 1302 0.01% 48 1295 0.01% 49 1397 0.01% 50 1343 0.01% 51 1450 0.01% 52 1419 0.01% 53 1424 0.01% 54 1495 0.01% 55 1546 0.01% 56 1510 0.01% 57 1604 0.01% 58 1660 0.01% 59 1730 0.01% 60 1788 0.01% 61 1796 0.01% 62 1885 0.01% 63 2006 0.01% 64 1964 0.01% 65 1945 0.01% 66 1973 0.01% 67 2118 0.01% 68 2137 0.01% 69 2277 0.01% 70 2472 0.01% 71 2567 0.01% 72 2741 0.01% 73 3270 0.02% 74 2959 0.01% 75 2965 0.01% 76 3012 0.02% 77 3176 0.02% 78 3549 0.02% 79 3828 0.02% 80 4193 0.02% 81 4592 0.02% 82 4923 0.02% 83 5474 0.03% 84 5872 0.03% 85 6162 0.03% 86 6728 0.03% 87 7270 0.04% 88 8270 0.04% 89 9303 0.05% 90 10469 0.05% 91 11897 0.06% 92 13384 0.07% 93 14933 0.07% 94 3049 0.02% 95 3078 0.02% 96 3155 0.02% 97 3499 0.02% 98 3571 0.02% 99 3798 0.02% 100 4149 0.02% 101 4246 0.02% 102 4420 0.02% 103 4722 0.02% 104 4799 0.02% 105 5061 0.03% 106 5788 0.03% 107 6224 0.03% 108 6795 0.03% 109 7463 0.04% 110 8057 0.04% 111 9136 0.05% 112 10046 0.05% 113 11667 0.06% 114 13131 0.07% 115 15262 0.08% 116 17740 0.09% 117 21463 0.11% 118 26611 0.13% 119 35592 0.18% 120 46822 0.24% 121 64294 0.32% 122 112031 0.56% 123 309519 1.55% 124 1224936 6.15% 125 17708340 88.88% 19923842 reads passed initial QC criterion=sequence-density sequence-density=3.70 sequence-density-rank=1 fanout-score=52.24 fanout-score-rank=1 prefix-density=5.08 prefix-fanout=38.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=3.70 sequence-density-rank=1 fanout-score=52.24 fanout-score-rank=1 prefix-density=5.08 prefix-fanout=38.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAA -o SRR3208050 - Input file: STDIN trimmed: SRR3208050-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:13:50 2025 >> started Wed Feb 12 04:14:01 2025 >> done (11.413s) 9961921 reads processed; of these: 124 ( 0.00%) short reads filtered out after trimming by size control 831 ( 0.01%) empty reads filtered out after trimming by size control 9960966 (99.99%) reads available; of these: 1190586 (11.95%) trimmed reads available after processing 8770380 (88.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 329 0.00% 19 346 0.00% 20 377 0.00% 21 352 0.00% 22 410 0.00% 23 456 0.00% 24 511 0.01% 25 577 0.01% 26 578 0.01% 27 568 0.01% 28 570 0.01% 29 644 0.01% 30 875 0.01% 31 865 0.01% 32 541 0.01% 33 510 0.01% 34 537 0.01% 35 542 0.01% 36 559 0.01% 37 617 0.01% 38 600 0.01% 39 579 0.01% 40 600 0.01% 41 628 0.01% 42 624 0.01% 43 562 0.01% 44 614 0.01% 45 595 0.01% 46 648 0.01% 47 698 0.01% 48 644 0.01% 49 697 0.01% 50 676 0.01% 51 742 0.01% 52 690 0.01% 53 716 0.01% 54 752 0.01% 55 824 0.01% 56 765 0.01% 57 807 0.01% 58 824 0.01% 59 833 0.01% 60 874 0.01% 61 893 0.01% 62 938 0.01% 63 1002 0.01% 64 1005 0.01% 65 1001 0.01% 66 1010 0.01% 67 1051 0.01% 68 1084 0.01% 69 1149 0.01% 70 1193 0.01% 71 1252 0.01% 72 1309 0.01% 73 1330 0.01% 74 1374 0.01% 75 1439 0.01% 76 1514 0.02% 77 1591 0.02% 78 1800 0.02% 79 1910 0.02% 80 2067 0.02% 81 2301 0.02% 82 2501 0.03% 83 2700 0.03% 84 2949 0.03% 85 3086 0.03% 86 3418 0.03% 87 3626 0.04% 88 4132 0.04% 89 4622 0.05% 90 5205 0.05% 91 5880 0.06% 92 6679 0.07% 93 7425 0.07% 94 8554 0.09% 95 9325 0.09% 96 9873 0.10% 97 11164 0.11% 98 12073 0.12% 99 13582 0.14% 100 15654 0.16% 101 17636 0.18% 102 20198 0.20% 103 22307 0.22% 104 24780 0.25% 105 25957 0.26% 106 27959 0.28% 107 29415 0.30% 108 31366 0.31% 109 34575 0.35% 110 37546 0.38% 111 41550 0.42% 112 46213 0.46% 113 50283 0.50% 114 54341 0.55% 115 58258 0.58% 116 60323 0.61% 117 63009 0.63% 118 67457 0.68% 119 75375 0.76% 120 95415 0.96% 121 141171 1.42% 122 301056 3.02% 123 138771 1.39% 124 556487 5.59% 125 7752101 77.82% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=62.25 fanout-score-rank=11 prefix-density=0.24 prefix-fanout=15.2 sequence=CACCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=521.64 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=16.8 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGA Started job on | Feb 12 04:14:31 Started mapping on | Feb 12 04:14:31 Finished on | Feb 12 04:15:03 Mapping speed, Million of reads per hour | 2241.32 Number of input reads | 19922887 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 18741435 Uniquely mapped reads % | 94.07% Average mapped length | 122.76 Number of splices: Total | 7058938 Number of splices: Annotated (sjdb) | 6919964 Number of splices: GT/AG | 6949140 Number of splices: GC/AG | 90019 Number of splices: AT/AC | 6982 Number of splices: Non-canonical | 12797 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404557 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 253749 % of reads mapped to too many loci | 1.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 776895 776895 776895 N_multimapping 404557 404557 404557 N_noFeature 819141 9713548 9709918 N_ambiguous 208468 35260 36507 UnstrandedReadsAssigned:17713826 PositiveStrandReadsAssigned:8992627 NegativeStrandReadsAssigned:8995010 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208050 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208050-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,922,887 reads, 18,287,781 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52401 SRR3208050.ke.tsv 34699 SRR3208050.se.tsv 87100 total ==> SRR3208050.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 494 19.4728 Potri.005G024800.1.v4.1 1035 936 98 7.92002 Potri.004G059700.1.v4.1 961 862 19 1.66733 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 248.479 6.609 Potri.016G087400.1.v4.1 270 171 777 343.717 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 57 2.5757 Potri.012G127500.1.v4.1 977 878 2638 227.277 ==> SRR3208050.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2218 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 368 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 54 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 51 SRR3208050 completed mapping pipeline successfully