Starting /dee2/code/volunteer_pipeline.sh SRR3208051 current disk space = 3049167904768 free memory = 1576899908 SRR3208051 SRAfilesize eaa52d61ce92efc28e10c72844f2e7ac SRR3208051.sra SRR3208051.sra file validated SRR3208051 is single end SRR3208051 is conventional basespace SRR3208051 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208051_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.54475 33.0 33.0 33.0 33.0 33.0 2 32.1625 33.0 33.0 33.0 33.0 33.0 3 32.28425 33.0 33.0 33.0 33.0 33.0 4 32.33275 33.0 33.0 33.0 33.0 33.0 5 32.3385 33.0 33.0 33.0 33.0 33.0 6 36.09 37.0 37.0 37.0 37.0 37.0 7 36.187 37.0 37.0 37.0 37.0 37.0 8 36.23225 37.0 37.0 37.0 37.0 37.0 9 36.294 37.0 37.0 37.0 37.0 37.0 10-11 36.2 37.0 37.0 37.0 37.0 37.0 12-13 36.20325 37.0 37.0 37.0 37.0 37.0 14-15 36.223875 37.0 37.0 37.0 37.0 37.0 16-17 36.217125 37.0 37.0 37.0 37.0 37.0 18-19 36.211625 37.0 37.0 37.0 37.0 37.0 20-21 36.26275 37.0 37.0 37.0 37.0 37.0 22-23 36.2355 37.0 37.0 37.0 37.0 37.0 24-25 36.213625 37.0 37.0 37.0 37.0 37.0 26-27 36.099625 37.0 37.0 37.0 37.0 37.0 28-29 36.16875 37.0 37.0 37.0 37.0 37.0 30-31 36.195875 37.0 37.0 37.0 37.0 37.0 32-33 36.19375 37.0 37.0 37.0 37.0 37.0 34-35 36.2225 37.0 37.0 37.0 37.0 37.0 36-37 36.154875000000004 37.0 37.0 37.0 37.0 37.0 38-39 36.17675 37.0 37.0 37.0 37.0 37.0 40-41 36.164125 37.0 37.0 37.0 37.0 37.0 42-43 36.204125000000005 37.0 37.0 37.0 37.0 37.0 44-45 36.160624999999996 37.0 37.0 37.0 37.0 37.0 46-47 36.172375 37.0 37.0 37.0 37.0 37.0 48-49 36.14975 37.0 37.0 37.0 37.0 37.0 50-51 36.19225 37.0 37.0 37.0 37.0 37.0 52-53 36.167375 37.0 37.0 37.0 37.0 37.0 54-55 36.099625 37.0 37.0 37.0 37.0 37.0 56-57 36.067499999999995 37.0 37.0 37.0 37.0 37.0 58-59 36.110625 37.0 37.0 37.0 37.0 37.0 60-61 36.081875 37.0 37.0 37.0 37.0 37.0 62-63 36.098375 37.0 37.0 37.0 37.0 37.0 64-65 36.08175 37.0 37.0 37.0 37.0 37.0 66-67 36.06425 37.0 37.0 37.0 37.0 37.0 68-69 36.040125 37.0 37.0 37.0 37.0 37.0 70-71 35.9925 37.0 37.0 37.0 37.0 37.0 72-73 35.983125 37.0 37.0 37.0 37.0 37.0 74-75 35.921125 37.0 37.0 37.0 37.0 37.0 76-77 35.927 37.0 37.0 37.0 37.0 37.0 78-79 35.905249999999995 37.0 37.0 37.0 37.0 37.0 80-81 35.973375000000004 37.0 37.0 37.0 37.0 37.0 82-83 35.914249999999996 37.0 37.0 37.0 37.0 37.0 84-85 35.83625 37.0 37.0 37.0 37.0 37.0 86-87 35.815375 37.0 37.0 37.0 37.0 37.0 88-89 35.83475 37.0 37.0 37.0 37.0 37.0 90-91 35.816375 37.0 37.0 37.0 37.0 37.0 92-93 35.833 37.0 37.0 37.0 37.0 37.0 94-95 35.7675 37.0 37.0 37.0 37.0 37.0 96-97 35.79025 37.0 37.0 37.0 37.0 37.0 98-99 35.717124999999996 37.0 37.0 37.0 37.0 37.0 100-101 35.695750000000004 37.0 37.0 37.0 37.0 37.0 102-103 35.701125 37.0 37.0 37.0 37.0 37.0 104-105 35.754125 37.0 37.0 37.0 37.0 37.0 106-107 35.73825 37.0 37.0 37.0 37.0 37.0 108-109 35.667625 37.0 37.0 37.0 37.0 37.0 110-111 35.620999999999995 37.0 37.0 37.0 37.0 37.0 112-113 35.5535 37.0 37.0 37.0 37.0 37.0 114-115 35.604625 37.0 37.0 37.0 37.0 37.0 116-117 35.44675 37.0 37.0 37.0 37.0 37.0 118-119 35.49325 37.0 37.0 37.0 37.0 37.0 120-121 35.463125000000005 37.0 37.0 37.0 37.0 37.0 122-123 35.395875000000004 37.0 37.0 37.0 37.0 37.0 124-125 33.77175 37.0 35.0 37.0 19.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 3.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 3.0 10 2.0 11 2.0 12 1.0 13 0.0 14 2.0 15 0.0 16 0.0 17 5.0 18 3.0 19 0.0 20 3.0 21 1.0 22 9.0 23 6.0 24 4.0 25 11.0 26 7.0 27 10.0 28 18.0 29 15.0 30 25.0 31 29.0 32 46.0 33 73.0 34 125.0 35 239.0 36 3325.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.564102564102562 16.256410256410255 12.461538461538462 49.717948717948715 2 18.4 21.5 39.95 20.150000000000002 3 20.775 25.275 27.900000000000002 26.05 4 23.875 31.874999999999996 21.3 22.95 5 25.05 33.800000000000004 23.825 17.325 6 19.275000000000002 35.6 24.375 20.75 7 18.45 19.375 42.5 19.675 8 18.65 23.400000000000002 31.85 26.1 9 20.825 22.05 32.5 24.625 10-11 22.425 32.5375 22.55 22.4875 12-13 20.3375 26.9625 28.849999999999998 23.849999999999998 14-15 21.212500000000002 27.237499999999997 29.7125 21.837500000000002 16-17 22.375 27.55 27.3625 22.7125 18-19 22.125 26.7125 27.962500000000002 23.200000000000003 20-21 21.775 27.85 28.65 21.725 22-23 22.675 27.925 27.175 22.225 24-25 21.7 28.549999999999997 27.3375 22.412499999999998 26-27 22.525000000000002 27.875 27.1625 22.4375 28-29 22.225 28.8625 27.35 21.5625 30-31 22.1 28.525 27.0625 22.3125 32-33 21.925 27.525 27.6625 22.8875 34-35 22.162499999999998 28.7375 27.125 21.975 36-37 21.337500000000002 27.975 28.012500000000003 22.675 38-39 22.325 27.400000000000002 27.212500000000002 23.0625 40-41 22.375 28.849999999999998 26.487500000000004 22.287499999999998 42-43 21.4125 28.849999999999998 27.6875 22.05 44-45 22.45 27.950000000000003 27.9375 21.6625 46-47 22.025 27.224999999999998 28.125 22.625 48-49 21.175 28.225 27.962500000000002 22.6375 50-51 22.4625 28.012500000000003 27.3 22.225 52-53 22.5875 28.9125 26.424999999999997 22.075 54-55 22.525000000000002 28.1875 27.175 22.112499999999997 56-57 21.9625 27.762500000000003 28.6625 21.6125 58-59 22.237499999999997 28.6375 27.474999999999998 21.65 60-61 22.8875 27.224999999999998 28.075 21.8125 62-63 22.2 28.15 27.6 22.05 64-65 22.05 28.375 27.9125 21.6625 66-67 22.5125 28.425 27.0875 21.975 68-69 21.075 28.725 27.525 22.675 70-71 22.3375 28.7 27.224999999999998 21.7375 72-73 21.75 28.3375 27.450000000000003 22.4625 74-75 22.3 27.762500000000003 27.6 22.3375 76-77 22.4375 28.749999999999996 27.1125 21.7 78-79 22.4375 28.225 27.237499999999997 22.1 80-81 22.2 28.237499999999997 26.9125 22.650000000000002 82-83 22.2125 27.2625 27.975 22.55 84-85 21.8875 28.6375 27.5125 21.9625 86-87 21.75 28.0625 28.325 21.8625 88-89 22.8875 28.275 26.924999999999997 21.912499999999998 90-91 22.25 27.962500000000002 27.6375 22.15 92-93 21.9 28.512500000000003 27.775 21.8125 94-95 22.775000000000002 27.675 28.487499999999997 21.0625 96-97 21.85 28.125 27.3 22.725 98-99 22.3375 27.537499999999998 27.962500000000002 22.162499999999998 100-101 22.4625 28.0875 27.725 21.725 102-103 22.55 27.575 27.675 22.2 104-105 22.2125 27.125 28.8875 21.775 106-107 21.975 28.1375 27.950000000000003 21.9375 108-109 22.912499999999998 27.487499999999997 27.712500000000002 21.8875 110-111 22.6375 28.787499999999998 26.75 21.825 112-113 24.075 28.462500000000002 25.775 21.6875 114-115 23.575 28.5625 27.0625 20.8 116-117 22.6375 28.749999999999996 26.637499999999996 21.975 118-119 23.849999999999998 29.275000000000002 25.575 21.3 120-121 22.237499999999997 29.862499999999997 25.9625 21.9375 122-123 23.425 29.2375 25.7375 21.6 124-125 22.95 29.7875 25.0625 22.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 2.0 25 4.0 26 7.5 27 10.0 28 14.5 29 23.0 30 26.5 31 30.5 32 40.0 33 50.0 34 60.0 35 80.5 36 97.5 37 114.0 38 138.5 39 161.0 40 174.0 41 188.0 42 217.5 43 222.0 44 237.0 45 268.0 46 257.0 47 236.5 48 225.5 49 203.5 50 156.5 51 122.0 52 117.0 53 109.0 54 77.5 55 51.0 56 44.5 57 39.0 58 29.5 59 23.5 60 21.0 61 15.5 62 13.0 63 14.5 64 12.5 65 7.5 66 8.5 67 8.0 68 6.5 69 5.5 70 5.5 71 3.5 72 2.0 73 3.5 74 3.5 75 3.0 76 1.5 77 1.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54739753583102 98.97500000000001 2 0.4023133014835303 0.8 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025144581342720643 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 6 0.15 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.0875 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.425 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.5 0.0 0.0 0.0 0.0 110-111 4.375 0.0 0.0 0.0 0.0 112-113 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra Read 1014455 spots for SRR3208051.sra Written 1014455 spots for SRR3208051.sra Read 1014441 spots for SRR3208051.sra Written 1014441 spots for SRR3208051.sra SRR ids: ['SRR3208051.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r8agszaf SRR3208051.sra spots: 20288834 blocks: [[1, 1014441], [1014442, 2028882], [2028883, 3043323], [3043324, 4057764], [4057765, 5072205], [5072206, 6086646], [6086647, 7101087], [7101088, 8115528], [8115529, 9129969], [9129970, 10144410], [10144411, 11158851], [11158852, 12173292], [12173293, 13187733], [13187734, 14202174], [14202175, 15216615], [15216616, 16231056], [16231057, 17245497], [17245498, 18259938], [18259939, 19274379], [19274380, 20288834]] SRR3208051 file size 6497757 SRR3208051 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208051 SRR3208051_1.fastq Input file: SRR3208051_1.fastq trimmed: SRR3208051-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:34:32 2025 >> started Wed Feb 12 04:34:44 2025 >> done (11.185s) 20288834 reads processed; of these: 15530 ( 0.08%) short reads filtered out after trimming by size control 90825 ( 0.45%) empty reads filtered out after trimming by size control 20182479 (99.48%) reads available; of these: 2265025 (11.22%) trimmed reads available after processing 17917454 (88.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 679 0.00% 19 688 0.00% 20 914 0.00% 21 773 0.00% 22 872 0.00% 23 970 0.00% 24 1118 0.01% 25 1268 0.01% 26 1416 0.01% 27 1156 0.01% 28 1231 0.01% 29 1313 0.01% 30 1578 0.01% 31 1488 0.01% 32 1127 0.01% 33 1124 0.01% 34 1157 0.01% 35 1113 0.01% 36 1171 0.01% 37 1142 0.01% 38 1172 0.01% 39 1198 0.01% 40 1194 0.01% 41 1256 0.01% 42 1240 0.01% 43 1298 0.01% 44 1344 0.01% 45 1305 0.01% 46 1372 0.01% 47 1356 0.01% 48 1407 0.01% 49 1405 0.01% 50 1456 0.01% 51 1475 0.01% 52 1546 0.01% 53 1556 0.01% 54 1463 0.01% 55 1616 0.01% 56 1682 0.01% 57 1768 0.01% 58 1747 0.01% 59 1879 0.01% 60 1981 0.01% 61 2001 0.01% 62 2064 0.01% 63 2130 0.01% 64 2201 0.01% 65 2663 0.01% 66 2282 0.01% 67 2407 0.01% 68 2522 0.01% 69 2665 0.01% 70 2842 0.01% 71 2922 0.01% 72 2973 0.01% 73 3229 0.02% 74 3382 0.02% 75 3856 0.02% 76 4174 0.02% 77 4245 0.02% 78 4228 0.02% 79 4640 0.02% 80 5102 0.03% 81 5579 0.03% 82 6231 0.03% 83 6821 0.03% 84 7321 0.04% 85 8016 0.04% 86 8580 0.04% 87 9554 0.05% 88 10527 0.05% 89 12032 0.06% 90 13509 0.07% 91 15358 0.08% 92 17619 0.09% 93 19455 0.10% 94 3147 0.02% 95 3172 0.02% 96 3470 0.02% 97 3755 0.02% 98 3705 0.02% 99 4046 0.02% 100 4188 0.02% 101 4354 0.02% 102 4751 0.02% 103 4816 0.02% 104 5108 0.03% 105 5420 0.03% 106 5705 0.03% 107 6279 0.03% 108 6931 0.03% 109 7437 0.04% 110 8181 0.04% 111 9190 0.05% 112 10207 0.05% 113 11622 0.06% 114 13391 0.07% 115 15430 0.08% 116 17901 0.09% 117 21452 0.11% 118 27127 0.13% 119 35910 0.18% 120 46326 0.23% 121 64793 0.32% 122 111932 0.55% 123 309898 1.54% 124 1226237 6.08% 125 17917454 88.78% 20182479 reads passed initial QC criterion=sequence-density sequence-density=4.62 sequence-density-rank=1 fanout-score=49.18 fanout-score-rank=1 prefix-density=6.26 prefix-fanout=36.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=4.62 sequence-density-rank=1 fanout-score=49.18 fanout-score-rank=1 prefix-density=6.26 prefix-fanout=36.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208051 - Input file: STDIN trimmed: SRR3208051-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:35:36 2025 >> started Wed Feb 12 04:35:50 2025 >> done (13.890s) 12109488 reads processed; of these: 235 ( 0.00%) short reads filtered out after trimming by size control 1423 ( 0.01%) empty reads filtered out after trimming by size control 12107830 (99.99%) reads available; of these: 1673283 (13.82%) trimmed reads available after processing 10434547 (86.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 416 0.00% 19 439 0.00% 20 576 0.00% 21 486 0.00% 22 537 0.00% 23 596 0.00% 24 690 0.01% 25 754 0.01% 26 1027 0.01% 27 710 0.01% 28 740 0.01% 29 770 0.01% 30 957 0.01% 31 898 0.01% 32 676 0.01% 33 654 0.01% 34 666 0.01% 35 675 0.01% 36 709 0.01% 37 695 0.01% 38 683 0.01% 39 694 0.01% 40 755 0.01% 41 769 0.01% 42 764 0.01% 43 797 0.01% 44 827 0.01% 45 799 0.01% 46 852 0.01% 47 829 0.01% 48 863 0.01% 49 853 0.01% 50 854 0.01% 51 880 0.01% 52 960 0.01% 53 961 0.01% 54 895 0.01% 55 942 0.01% 56 1048 0.01% 57 1094 0.01% 58 1065 0.01% 59 1136 0.01% 60 1183 0.01% 61 1196 0.01% 62 1267 0.01% 63 1224 0.01% 64 1264 0.01% 65 1437 0.01% 66 1353 0.01% 67 1503 0.01% 68 1525 0.01% 69 1614 0.01% 70 1746 0.01% 71 1742 0.01% 72 1789 0.01% 73 1886 0.02% 74 1950 0.02% 75 2033 0.02% 76 2147 0.02% 77 2427 0.02% 78 2472 0.02% 79 2810 0.02% 80 3051 0.03% 81 3399 0.03% 82 3746 0.03% 83 4118 0.03% 84 4445 0.04% 85 4925 0.04% 86 5131 0.04% 87 5847 0.05% 88 6345 0.05% 89 7268 0.06% 90 8099 0.07% 91 9047 0.07% 92 10338 0.09% 93 11875 0.10% 94 13148 0.11% 95 14364 0.12% 96 15520 0.13% 97 17034 0.14% 98 18911 0.16% 99 21247 0.18% 100 23577 0.19% 101 26501 0.22% 102 30451 0.25% 103 33480 0.28% 104 36822 0.30% 105 39097 0.32% 106 41134 0.34% 107 44071 0.36% 108 46820 0.39% 109 50321 0.42% 110 55135 0.46% 111 60372 0.50% 112 66918 0.55% 113 71816 0.59% 114 77211 0.64% 115 81294 0.67% 116 84861 0.70% 117 88474 0.73% 118 93461 0.77% 119 103442 0.85% 120 126249 1.04% 121 178120 1.47% 122 370525 3.06% 123 165337 1.37% 124 659724 5.45% 125 9197200 75.96% criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=21 prefix-density=0.17 prefix-fanout=3.0 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=83.21 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.9 sequence=AGAAAGAAAGAA Started job on | Feb 12 04:36:21 Started mapping on | Feb 12 04:36:22 Finished on | Feb 12 04:37:06 Mapping speed, Million of reads per hour | 1651.16 Number of input reads | 20180821 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 17437258 Uniquely mapped reads % | 86.41% Average mapped length | 122.46 Number of splices: Total | 6209614 Number of splices: Annotated (sjdb) | 6092340 Number of splices: GT/AG | 6115363 Number of splices: GC/AG | 76248 Number of splices: AT/AC | 6352 Number of splices: Non-canonical | 11651 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403353 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 1089569 % of reads mapped to too many loci | 5.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.14% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2340210 2340210 2340210 N_multimapping 403353 403353 403353 N_noFeature 693869 8979787 9004038 N_ambiguous 206688 29948 29885 UnstrandedReadsAssigned:16536701 PositiveStrandReadsAssigned:8427523 NegativeStrandReadsAssigned:8403335 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208051 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208051-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,180,821 reads, 17,874,329 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR3208051.ke.tsv 34699 SRR3208051.se.tsv 87100 total ==> SRR3208051.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 509 19.4282 Potri.005G024800.1.v4.1 1035 936 84 6.57344 Potri.004G059700.1.v4.1 961 862 29 2.46422 Potri.007G009000.2.v4.1 1416 1317 1 0.0556164 Potri.003G141000.2.v4.1 2943 2844 205.243 5.28601 Potri.016G087400.1.v4.1 270 171 935.457 400.698 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 60 2.62534 Potri.012G127500.1.v4.1 977 878 3357 280.057 ==> SRR3208051.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1784 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 432 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3208051 completed mapping pipeline successfully