Starting /dee2/code/volunteer_pipeline.sh SRR3208052 current disk space = 3049124741120 free memory = 1579441548 SRR3208052 SRAfilesize 9ca5b77f43ae44217e8cdffc905da62d SRR3208052.sra SRR3208052.sra file validated SRR3208052 is single end SRR3208052 is conventional basespace SRR3208052 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208052_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.33175 33.0 33.0 33.0 33.0 33.0 2 32.0145 33.0 33.0 33.0 33.0 33.0 3 32.1525 33.0 33.0 33.0 33.0 33.0 4 32.21925 33.0 33.0 33.0 33.0 33.0 5 32.2435 33.0 33.0 33.0 33.0 33.0 6 36.05175 37.0 37.0 37.0 37.0 37.0 7 36.1435 37.0 37.0 37.0 37.0 37.0 8 36.16425 37.0 37.0 37.0 37.0 37.0 9 36.188 37.0 37.0 37.0 37.0 37.0 10-11 36.16375 37.0 37.0 37.0 37.0 37.0 12-13 36.161249999999995 37.0 37.0 37.0 37.0 37.0 14-15 36.1715 37.0 37.0 37.0 37.0 37.0 16-17 36.201750000000004 37.0 37.0 37.0 37.0 37.0 18-19 36.153875 37.0 37.0 37.0 37.0 37.0 20-21 36.144875 37.0 37.0 37.0 37.0 37.0 22-23 36.18725 37.0 37.0 37.0 37.0 37.0 24-25 36.14675 37.0 37.0 37.0 37.0 37.0 26-27 36.073499999999996 37.0 37.0 37.0 37.0 37.0 28-29 36.06725 37.0 37.0 37.0 37.0 37.0 30-31 36.074625 37.0 37.0 37.0 37.0 37.0 32-33 36.098 37.0 37.0 37.0 37.0 37.0 34-35 36.102375 37.0 37.0 37.0 37.0 37.0 36-37 36.059375 37.0 37.0 37.0 37.0 37.0 38-39 36.0925 37.0 37.0 37.0 37.0 37.0 40-41 36.02775 37.0 37.0 37.0 37.0 37.0 42-43 36.06 37.0 37.0 37.0 37.0 37.0 44-45 36.091875 37.0 37.0 37.0 37.0 37.0 46-47 36.089124999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.051625 37.0 37.0 37.0 37.0 37.0 50-51 36.0325 37.0 37.0 37.0 37.0 37.0 52-53 36.067499999999995 37.0 37.0 37.0 37.0 37.0 54-55 36.026250000000005 37.0 37.0 37.0 37.0 37.0 56-57 35.99575 37.0 37.0 37.0 37.0 37.0 58-59 35.963499999999996 37.0 37.0 37.0 37.0 37.0 60-61 35.97875 37.0 37.0 37.0 37.0 37.0 62-63 35.90325 37.0 37.0 37.0 37.0 37.0 64-65 35.95075 37.0 37.0 37.0 37.0 37.0 66-67 35.916624999999996 37.0 37.0 37.0 37.0 37.0 68-69 35.982875 37.0 37.0 37.0 37.0 37.0 70-71 35.932249999999996 37.0 37.0 37.0 37.0 37.0 72-73 35.918625 37.0 37.0 37.0 37.0 37.0 74-75 35.82625 37.0 37.0 37.0 37.0 37.0 76-77 35.697125 37.0 37.0 37.0 37.0 37.0 78-79 35.718375 37.0 37.0 37.0 37.0 37.0 80-81 35.678375 37.0 37.0 37.0 37.0 37.0 82-83 35.667125 37.0 37.0 37.0 37.0 37.0 84-85 35.6985 37.0 37.0 37.0 37.0 37.0 86-87 35.709999999999994 37.0 37.0 37.0 37.0 37.0 88-89 35.6315 37.0 37.0 37.0 37.0 37.0 90-91 35.603625 37.0 37.0 37.0 37.0 37.0 92-93 35.5215 37.0 37.0 37.0 37.0 37.0 94-95 35.5755 37.0 37.0 37.0 37.0 37.0 96-97 35.49225 37.0 37.0 37.0 37.0 37.0 98-99 35.488125 37.0 37.0 37.0 37.0 37.0 100-101 35.518249999999995 37.0 37.0 37.0 37.0 37.0 102-103 35.5115 37.0 37.0 37.0 37.0 37.0 104-105 35.49575 37.0 37.0 37.0 37.0 37.0 106-107 35.492000000000004 37.0 37.0 37.0 37.0 37.0 108-109 35.484875 37.0 37.0 37.0 37.0 37.0 110-111 35.43275 37.0 37.0 37.0 35.0 37.0 112-113 35.371750000000006 37.0 37.0 37.0 35.0 37.0 114-115 35.346125 37.0 37.0 37.0 35.0 37.0 116-117 35.279125 37.0 37.0 37.0 35.0 37.0 118-119 35.18825 37.0 37.0 37.0 35.0 37.0 120-121 35.066375 37.0 37.0 37.0 33.0 37.0 122-123 35.035 37.0 37.0 37.0 33.0 37.0 124-125 33.41975 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 0.0 4 1.0 5 0.0 6 2.0 7 0.0 8 2.0 9 1.0 10 1.0 11 1.0 12 2.0 13 1.0 14 0.0 15 3.0 16 2.0 17 3.0 18 2.0 19 1.0 20 5.0 21 3.0 22 16.0 23 8.0 24 7.0 25 8.0 26 9.0 27 11.0 28 19.0 29 39.0 30 28.0 31 40.0 32 65.0 33 86.0 34 114.0 35 213.0 36 3273.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.535291087068522 14.683153013910355 12.622359608449251 51.15919629057187 2 19.325 20.7 41.05 18.925 3 20.549999999999997 25.5 27.55 26.400000000000002 4 24.6 29.425 21.6 24.375 5 25.35 33.1 21.925 19.625 6 19.6 36.7 24.425 19.275000000000002 7 17.224999999999998 19.925 43.3 19.55 8 18.229557389347338 23.23080770192548 31.657914478619652 26.881720430107524 9 20.225 22.225 32.15 25.4 10-11 21.3625 32.725 23.962500000000002 21.95 12-13 20.3375 26.650000000000002 29.512500000000003 23.5 14-15 20.875 28.0875 28.599999999999998 22.4375 16-17 21.85 28.1625 27.0125 22.975 18-19 21.8625 27.8625 27.462500000000002 22.8125 20-21 21.1375 28.125 28.6375 22.1 22-23 21.7 28.6875 26.974999999999998 22.6375 24-25 20.962500000000002 28.8375 27.3875 22.8125 26-27 21.230307576894223 28.844711177794448 27.26931732933233 22.655663915978995 28-29 21.408028010503937 27.960485181943227 27.635363261222956 22.996123546329876 30-31 21.023011505752876 27.951475737868936 28.189094547273637 22.836418209104554 32-33 21.491118338754063 27.77082812109082 27.558168626469854 23.179884913685264 34-35 21.6260162601626 28.13008130081301 27.5797373358349 22.664165103189493 36-37 22.236118059029515 27.138569284642323 27.901450725362682 22.723861930965484 38-39 21.77772221527691 27.715964495561945 28.003500437554695 22.502812851606453 40-41 22.037499999999998 27.6625 28.249999999999996 22.05 42-43 21.077634704338042 28.491061382672832 28.391048881110137 22.040255031878985 44-45 21.712500000000002 28.812500000000004 27.6 21.875 46-47 20.5625 28.499999999999996 28.212500000000002 22.725 48-49 21.85 28.3875 26.5125 23.25 50-51 20.8125 28.012500000000003 28.962500000000002 22.2125 52-53 21.4875 27.950000000000003 27.125 23.4375 54-55 21.325 27.487499999999997 27.975 23.2125 56-57 21.1625 28.9875 27.900000000000002 21.95 58-59 21.875 28.0875 27.3625 22.675 60-61 21.75 27.900000000000002 27.925 22.425 62-63 22.4875 26.3125 28.537499999999998 22.662499999999998 64-65 22.325 27.500000000000004 28.95 21.224999999999998 66-67 22.7625 27.525 27.500000000000004 22.2125 68-69 22.775000000000002 29.349999999999998 26.9625 20.9125 70-71 21.987499999999997 28.775000000000002 27.3125 21.925 72-73 21.8 28.475 27.6625 22.0625 74-75 21.475 28.5875 28.0875 21.85 76-77 21.7875 28.4 26.687499999999996 23.125 78-79 22.3625 28.249999999999996 26.474999999999998 22.912499999999998 80-81 22.4625 28.349999999999998 27.5625 21.625 82-83 22.85 28.0625 27.9125 21.175 84-85 22.900000000000002 27.450000000000003 27.462500000000002 22.1875 86-87 22.787499999999998 28.075 27.800000000000004 21.337500000000002 88-89 21.8 28.125 27.700000000000003 22.375 90-91 21.4875 27.750000000000004 27.925 22.8375 92-93 21.987499999999997 27.5625 28.1875 22.2625 94-95 22.025 27.825 28.799999999999997 21.349999999999998 96-97 22.5875 27.0875 28.037499999999998 22.287499999999998 98-99 22.650000000000002 27.05 27.700000000000003 22.6 100-101 21.9625 27.575 28.3625 22.1 102-103 22.95 27.950000000000003 27.037499999999998 22.0625 104-105 23.325000000000003 28.6375 27.437499999999996 20.599999999999998 106-107 22.6375 28.4 27.3625 21.6 108-109 22.025 28.050000000000004 27.1 22.825 110-111 23.2625 28.5875 26.687499999999996 21.462500000000002 112-113 22.5875 29.5375 26.487500000000004 21.3875 114-115 23.2875 28.787499999999998 26.275 21.65 116-117 22.15 28.375 27.3125 22.162499999999998 118-119 23.0375 29.4375 25.575 21.95 120-121 23.9875 28.425 25.5375 22.05 122-123 23.7375 27.950000000000003 26.775 21.5375 124-125 23.674999999999997 28.175 26.275 21.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 3.5 26 5.0 27 5.5 28 7.5 29 12.5 30 23.0 31 28.5 32 31.0 33 41.0 34 54.5 35 67.5 36 84.5 37 102.5 38 134.0 39 167.5 40 197.0 41 223.5 42 241.0 43 275.0 44 280.5 45 258.0 46 239.0 47 237.5 48 233.0 49 187.5 50 161.0 51 140.0 52 109.5 53 99.0 54 78.0 55 52.0 56 37.5 57 32.5 58 27.0 59 20.5 60 17.0 61 13.5 62 11.5 63 7.0 64 5.0 65 5.5 66 5.5 67 5.5 68 5.0 69 5.0 70 3.0 71 1.0 72 2.5 73 2.5 74 2.5 75 3.0 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.0375 30-31 0.05 32-33 0.075 34-35 0.0625 36-37 0.05 38-39 0.0125 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82394366197182 99.225 2 0.12575452716297786 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025150905432595575 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025150905432595575 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 14 (97% over 44bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTA 7 0.17500000000000002 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.175 0.0 0.0 0.0 0.0 12-13 0.175 0.0 0.0 0.0 0.0 14-15 0.175 0.0 0.0 0.0 0.0 16-17 0.175 0.0 0.0 0.0 0.0 18-19 0.175 0.0 0.0 0.0 0.0 20-21 0.175 0.0 0.0 0.0 0.0 22-23 0.175 0.0 0.0 0.0 0.0 24-25 0.175 0.0 0.0 0.0 0.0 26-27 0.175 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.2 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.2 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.2 0.0 0.0 0.0 0.0 54-55 0.2 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.6124999999999998 0.0 0.0 0.0 0.0 100-101 1.8624999999999998 0.0 0.0 0.0 0.0 102-103 2.2625 0.0 0.0 0.0 0.0 104-105 2.75 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.7875 0.0 0.0 0.0 0.0 110-111 4.325 0.0 0.0 0.0 0.0 112-113 5.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGGTG 15 0.004088022 59.4875 84-85 >>END_MODULE Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989371 spots for SRR3208052.sra Written 989371 spots for SRR3208052.sra Read 989378 spots for SRR3208052.sra Written 989378 spots for SRR3208052.sra SRR ids: ['SRR3208052.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2w2t9uyq SRR3208052.sra spots: 19787427 blocks: [[1, 989371], [989372, 1978742], [1978743, 2968113], [2968114, 3957484], [3957485, 4946855], [4946856, 5936226], [5936227, 6925597], [6925598, 7914968], [7914969, 8904339], [8904340, 9893710], [9893711, 10883081], [10883082, 11872452], [11872453, 12861823], [12861824, 13851194], [13851195, 14840565], [14840566, 15829936], [15829937, 16819307], [16819308, 17808678], [17808679, 18798049], [18798050, 19787427]] SRR3208052 file size 6336908 SRR3208052 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208052 SRR3208052_1.fastq Input file: SRR3208052_1.fastq trimmed: SRR3208052-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:08:13 2025 >> started Wed Feb 12 04:08:24 2025 >> done (11.059s) 19787427 reads processed; of these: 16420 ( 0.08%) short reads filtered out after trimming by size control 115531 ( 0.58%) empty reads filtered out after trimming by size control 19655476 (99.33%) reads available; of these: 2217543 (11.28%) trimmed reads available after processing 17437933 (88.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 742 0.00% 19 774 0.00% 20 1001 0.01% 21 774 0.00% 22 851 0.00% 23 949 0.00% 24 1156 0.01% 25 1218 0.01% 26 1284 0.01% 27 1053 0.01% 28 1192 0.01% 29 1312 0.01% 30 1701 0.01% 31 1843 0.01% 32 1202 0.01% 33 1016 0.01% 34 1118 0.01% 35 1077 0.01% 36 1075 0.01% 37 1123 0.01% 38 1093 0.01% 39 1185 0.01% 40 1136 0.01% 41 1190 0.01% 42 1189 0.01% 43 1239 0.01% 44 1236 0.01% 45 1202 0.01% 46 1315 0.01% 47 1261 0.01% 48 1273 0.01% 49 1359 0.01% 50 1402 0.01% 51 1426 0.01% 52 1407 0.01% 53 1490 0.01% 54 1478 0.01% 55 1504 0.01% 56 1553 0.01% 57 1620 0.01% 58 1720 0.01% 59 1788 0.01% 60 1742 0.01% 61 1870 0.01% 62 1880 0.01% 63 1972 0.01% 64 2023 0.01% 65 2332 0.01% 66 2093 0.01% 67 2140 0.01% 68 2215 0.01% 69 2374 0.01% 70 2636 0.01% 71 2641 0.01% 72 2805 0.01% 73 3036 0.02% 74 3162 0.02% 75 3569 0.02% 76 4212 0.02% 77 3760 0.02% 78 3848 0.02% 79 4237 0.02% 80 4679 0.02% 81 5265 0.03% 82 5707 0.03% 83 6451 0.03% 84 6894 0.04% 85 7443 0.04% 86 8034 0.04% 87 8815 0.04% 88 9668 0.05% 89 10934 0.06% 90 12760 0.06% 91 14564 0.07% 92 16497 0.08% 93 18487 0.09% 94 3054 0.02% 95 3158 0.02% 96 3272 0.02% 97 3586 0.02% 98 3627 0.02% 99 3818 0.02% 100 4000 0.02% 101 4314 0.02% 102 4480 0.02% 103 4629 0.02% 104 4722 0.02% 105 5172 0.03% 106 5574 0.03% 107 6219 0.03% 108 6794 0.03% 109 7433 0.04% 110 8171 0.04% 111 8956 0.05% 112 9894 0.05% 113 11442 0.06% 114 13218 0.07% 115 15082 0.08% 116 17677 0.09% 117 21431 0.11% 118 26728 0.14% 119 35769 0.18% 120 46071 0.23% 121 64346 0.33% 122 111411 0.57% 123 305730 1.56% 124 1204493 6.13% 125 17437933 88.72% 19655476 reads passed initial QC criterion=sequence-density sequence-density=4.48 sequence-density-rank=1 fanout-score=47.68 fanout-score-rank=1 prefix-density=6.07 prefix-fanout=35.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=4.48 sequence-density-rank=1 fanout-score=47.68 fanout-score-rank=1 prefix-density=6.07 prefix-fanout=35.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208052 - Input file: STDIN trimmed: SRR3208052-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:09:12 2025 >> started Wed Feb 12 04:09:25 2025 >> done (12.491s) 11793286 reads processed; of these: 218 ( 0.00%) short reads filtered out after trimming by size control 1581 ( 0.01%) empty reads filtered out after trimming by size control 11791487 (99.98%) reads available; of these: 1595732 (13.53%) trimmed reads available after processing 10195755 (86.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 456 0.00% 19 518 0.00% 20 634 0.01% 21 475 0.00% 22 524 0.00% 23 598 0.01% 24 697 0.01% 25 731 0.01% 26 756 0.01% 27 623 0.01% 28 715 0.01% 29 797 0.01% 30 1029 0.01% 31 1099 0.01% 32 731 0.01% 33 628 0.01% 34 674 0.01% 35 647 0.01% 36 648 0.01% 37 693 0.01% 38 679 0.01% 39 737 0.01% 40 704 0.01% 41 710 0.01% 42 762 0.01% 43 716 0.01% 44 786 0.01% 45 714 0.01% 46 801 0.01% 47 751 0.01% 48 746 0.01% 49 819 0.01% 50 861 0.01% 51 867 0.01% 52 868 0.01% 53 868 0.01% 54 884 0.01% 55 937 0.01% 56 951 0.01% 57 962 0.01% 58 1038 0.01% 59 1082 0.01% 60 1051 0.01% 61 1127 0.01% 62 1131 0.01% 63 1190 0.01% 64 1169 0.01% 65 1215 0.01% 66 1249 0.01% 67 1252 0.01% 68 1308 0.01% 69 1402 0.01% 70 1572 0.01% 71 1577 0.01% 72 1677 0.01% 73 1787 0.02% 74 1798 0.02% 75 1864 0.02% 76 1961 0.02% 77 2198 0.02% 78 2301 0.02% 79 2566 0.02% 80 2837 0.02% 81 3137 0.03% 82 3414 0.03% 83 3868 0.03% 84 4132 0.04% 85 4396 0.04% 86 4747 0.04% 87 5298 0.04% 88 5846 0.05% 89 6511 0.06% 90 7623 0.06% 91 8662 0.07% 92 9780 0.08% 93 11140 0.09% 94 12454 0.11% 95 13844 0.12% 96 14737 0.12% 97 16108 0.14% 98 17772 0.15% 99 19912 0.17% 100 22251 0.19% 101 25310 0.21% 102 28876 0.24% 103 32231 0.27% 104 34907 0.30% 105 37728 0.32% 106 39470 0.33% 107 41792 0.35% 108 43918 0.37% 109 47366 0.40% 110 52313 0.44% 111 57142 0.48% 112 63169 0.54% 113 68275 0.58% 114 73606 0.62% 115 77058 0.65% 116 80804 0.69% 117 83628 0.71% 118 88453 0.75% 119 98559 0.84% 120 120597 1.02% 121 173955 1.48% 122 363916 3.09% 123 163283 1.38% 124 646583 5.48% 125 8986768 76.21% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=76.48 fanout-score-rank=6 prefix-density=0.28 prefix-fanout=17.5 sequence=TTCTTTCTTTCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=308.34 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=30.2 sequence=CTTCTTCTTCTT Started job on | Feb 12 04:09:54 Started mapping on | Feb 12 04:09:55 Finished on | Feb 12 04:10:25 Mapping speed, Million of reads per hour | 2358.44 Number of input reads | 19653677 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 18263912 Uniquely mapped reads % | 92.93% Average mapped length | 122.48 Number of splices: Total | 6822748 Number of splices: Annotated (sjdb) | 6695946 Number of splices: GT/AG | 6718828 Number of splices: GC/AG | 84865 Number of splices: AT/AC | 6979 Number of splices: Non-canonical | 12076 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 392019 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 466305 % of reads mapped to too many loci | 2.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 997746 997746 997746 N_multimapping 392019 392019 392019 N_noFeature 715305 9421419 9424196 N_ambiguous 196929 31628 32070 UnstrandedReadsAssigned:17351678 PositiveStrandReadsAssigned:8810865 NegativeStrandReadsAssigned:8807646 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208052 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208052-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,653,677 reads, 18,094,841 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR3208052.ke.tsv 34699 SRR3208052.se.tsv 87100 total ==> SRR3208052.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 580 22.6161 Potri.005G024800.1.v4.1 1035 936 76 6.0758 Potri.004G059700.1.v4.1 961 862 30 2.60423 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 227.204 5.97793 Potri.016G087400.1.v4.1 270 171 976 427.09 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 44 1.96681 Potri.012G127500.1.v4.1 977 878 3773 321.557 ==> SRR3208052.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1393 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3208052 completed mapping pipeline successfully