Starting /dee2/code/volunteer_pipeline.sh SRR3208053 current disk space = 3049154494464 free memory = 1407291276 SRR3208053 SRAfilesize 4930cdb3fe0297471f50a100b7a6bb35 SRR3208053.sra SRR3208053.sra file validated SRR3208053 is single end SRR3208053 is conventional basespace SRR3208053 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208053_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.52275 33.0 33.0 33.0 33.0 33.0 2 32.099 33.0 33.0 33.0 33.0 33.0 3 32.17975 33.0 33.0 33.0 33.0 33.0 4 32.30125 33.0 33.0 33.0 33.0 33.0 5 32.26575 33.0 33.0 33.0 33.0 33.0 6 36.0125 37.0 37.0 37.0 37.0 37.0 7 36.09175 37.0 37.0 37.0 37.0 37.0 8 36.19925 37.0 37.0 37.0 37.0 37.0 9 36.18675 37.0 37.0 37.0 37.0 37.0 10-11 36.13825 37.0 37.0 37.0 37.0 37.0 12-13 36.136625 37.0 37.0 37.0 37.0 37.0 14-15 36.189875 37.0 37.0 37.0 37.0 37.0 16-17 36.13225 37.0 37.0 37.0 37.0 37.0 18-19 36.148875000000004 37.0 37.0 37.0 37.0 37.0 20-21 36.1225 37.0 37.0 37.0 37.0 37.0 22-23 36.151125 37.0 37.0 37.0 37.0 37.0 24-25 36.083875 37.0 37.0 37.0 37.0 37.0 26-27 36.032375 37.0 37.0 37.0 37.0 37.0 28-29 36.091 37.0 37.0 37.0 37.0 37.0 30-31 36.096375 37.0 37.0 37.0 37.0 37.0 32-33 36.0655 37.0 37.0 37.0 37.0 37.0 34-35 36.06675 37.0 37.0 37.0 37.0 37.0 36-37 36.0835 37.0 37.0 37.0 37.0 37.0 38-39 36.026250000000005 37.0 37.0 37.0 37.0 37.0 40-41 36.027625 37.0 37.0 37.0 37.0 37.0 42-43 36.053875000000005 37.0 37.0 37.0 37.0 37.0 44-45 36.083125 37.0 37.0 37.0 37.0 37.0 46-47 36.058875 37.0 37.0 37.0 37.0 37.0 48-49 36.018125 37.0 37.0 37.0 37.0 37.0 50-51 36.041875000000005 37.0 37.0 37.0 37.0 37.0 52-53 36.046125 37.0 37.0 37.0 37.0 37.0 54-55 36.000375 37.0 37.0 37.0 37.0 37.0 56-57 36.004999999999995 37.0 37.0 37.0 37.0 37.0 58-59 36.011375 37.0 37.0 37.0 37.0 37.0 60-61 35.968374999999995 37.0 37.0 37.0 37.0 37.0 62-63 36.050875000000005 37.0 37.0 37.0 37.0 37.0 64-65 36.004000000000005 37.0 37.0 37.0 37.0 37.0 66-67 35.917125 37.0 37.0 37.0 37.0 37.0 68-69 35.942125000000004 37.0 37.0 37.0 37.0 37.0 70-71 35.88525 37.0 37.0 37.0 37.0 37.0 72-73 35.85525 37.0 37.0 37.0 37.0 37.0 74-75 35.873000000000005 37.0 37.0 37.0 37.0 37.0 76-77 35.704125000000005 37.0 37.0 37.0 37.0 37.0 78-79 35.65925 37.0 37.0 37.0 37.0 37.0 80-81 35.679125 37.0 37.0 37.0 37.0 37.0 82-83 35.714375000000004 37.0 37.0 37.0 37.0 37.0 84-85 35.663250000000005 37.0 37.0 37.0 37.0 37.0 86-87 35.71475 37.0 37.0 37.0 37.0 37.0 88-89 35.585375 37.0 37.0 37.0 37.0 37.0 90-91 35.64675 37.0 37.0 37.0 37.0 37.0 92-93 35.585499999999996 37.0 37.0 37.0 37.0 37.0 94-95 35.588125000000005 37.0 37.0 37.0 37.0 37.0 96-97 35.54875 37.0 37.0 37.0 37.0 37.0 98-99 35.564125000000004 37.0 37.0 37.0 37.0 37.0 100-101 35.520875 37.0 37.0 37.0 37.0 37.0 102-103 35.516625 37.0 37.0 37.0 37.0 37.0 104-105 35.518 37.0 37.0 37.0 37.0 37.0 106-107 35.485375000000005 37.0 37.0 37.0 37.0 37.0 108-109 35.437749999999994 37.0 37.0 37.0 37.0 37.0 110-111 35.444125 37.0 37.0 37.0 37.0 37.0 112-113 35.348749999999995 37.0 37.0 37.0 37.0 37.0 114-115 35.43325 37.0 37.0 37.0 37.0 37.0 116-117 35.324124999999995 37.0 37.0 37.0 37.0 37.0 118-119 35.323125 37.0 37.0 37.0 37.0 37.0 120-121 35.211124999999996 37.0 37.0 37.0 37.0 37.0 122-123 35.15475 37.0 37.0 37.0 37.0 37.0 124-125 33.5635 37.0 35.0 37.0 19.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 44.0 3 2.0 4 2.0 5 1.0 6 0.0 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 4.0 14 3.0 15 1.0 16 0.0 17 2.0 18 0.0 19 2.0 20 2.0 21 5.0 22 16.0 23 11.0 24 4.0 25 6.0 26 8.0 27 11.0 28 13.0 29 23.0 30 27.0 31 38.0 32 56.0 33 78.0 34 101.0 35 202.0 36 3335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.30089628681178 15.390524967989757 12.266325224071704 47.04225352112676 2 19.0 21.349999999999998 40.975 18.675 3 20.724999999999998 24.625 28.999999999999996 25.650000000000002 4 23.7 30.875000000000004 21.0 24.425 5 26.55 33.6 23.35 16.5 6 20.8 35.9 22.45 20.849999999999998 7 18.125 20.075000000000003 42.65 19.15 8 18.6 25.124999999999996 29.525000000000002 26.75 9 20.349999999999998 22.95 31.15 25.55 10-11 23.3125 33.137499999999996 22.7 20.849999999999998 12-13 20.7125 27.375 28.962500000000002 22.95 14-15 20.7375 28.15 28.65 22.4625 16-17 22.287499999999998 27.825 27.625 22.2625 18-19 21.875 28.0875 27.85 22.1875 20-21 22.900000000000002 27.400000000000002 26.8125 22.8875 22-23 22.025 30.012499999999996 27.175 20.7875 24-25 22.1875 28.4375 27.474999999999998 21.9 26-27 21.5625 27.125 27.35 23.962500000000002 28-29 22.4375 27.5625 27.900000000000002 22.1 30-31 21.6875 28.287499999999998 27.625 22.400000000000002 32-33 21.705426356589147 29.019754938734682 27.069267316829208 22.20555138784696 34-35 21.765220652581576 28.59107388423553 27.91598949868734 21.727715964495562 36-37 22.075 28.3625 27.925 21.637500000000003 38-39 21.85 29.125 27.075 21.95 40-41 22.7375 28.6875 26.775 21.8 42-43 20.9875 29.5375 27.737499999999997 21.7375 44-45 21.8875 27.737499999999997 28.5625 21.8125 46-47 22.0875 27.400000000000002 27.462500000000002 23.05 48-49 21.3 28.9375 28.0875 21.675 50-51 22.625 27.6625 28.075 21.637500000000003 52-53 22.6375 28.125 27.1125 22.125 54-55 22.225 28.512500000000003 27.6 21.6625 56-57 21.587500000000002 27.6 28.999999999999996 21.8125 58-59 21.2875 28.000000000000004 28.962500000000002 21.75 60-61 21.712500000000002 27.400000000000002 28.975 21.912499999999998 62-63 22.5 27.5875 28.775000000000002 21.1375 64-65 22.075 27.150000000000002 28.849999999999998 21.925 66-67 20.6625 29.4875 27.375 22.475 68-69 21.349999999999998 28.762500000000003 27.950000000000003 21.9375 70-71 21.45 29.325000000000003 27.437499999999996 21.7875 72-73 21.15 28.812500000000004 27.675 22.3625 74-75 22.162499999999998 28.275 27.5625 22.0 76-77 22.4875 29.4375 27.025 21.05 78-79 21.4125 28.599999999999998 27.6 22.3875 80-81 21.75 28.075 27.8375 22.3375 82-83 22.175 28.525 27.275 22.025 84-85 21.9 28.9125 27.3875 21.8 86-87 21.9375 27.35 28.6875 22.025 88-89 22.9375 28.575 27.250000000000004 21.2375 90-91 21.712500000000002 28.6625 27.675 21.95 92-93 22.225 28.037499999999998 27.437499999999996 22.3 94-95 22.112499999999997 27.987499999999997 27.425 22.475 96-97 22.725 27.650000000000002 27.962500000000002 21.6625 98-99 22.5 27.5875 27.224999999999998 22.6875 100-101 22.125 28.9 27.487499999999997 21.4875 102-103 23.1125 28.000000000000004 27.437499999999996 21.45 104-105 22.425 27.925 27.650000000000002 22.0 106-107 22.675 28.725 26.424999999999997 22.175 108-109 22.2125 28.9875 27.6375 21.1625 110-111 23.1 28.425 27.025 21.45 112-113 22.8875 28.537499999999998 26.8 21.775 114-115 22.0 29.037499999999998 26.575 22.3875 116-117 22.9375 29.0875 26.2625 21.712500000000002 118-119 23.225 28.325 26.5875 21.8625 120-121 23.0625 29.4 25.4875 22.05 122-123 23.4375 29.7125 25.2875 21.5625 124-125 22.3875 29.2875 25.7125 22.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 4.5 26 8.5 27 7.5 28 7.0 29 14.5 30 24.0 31 28.0 32 28.0 33 45.0 34 62.5 35 78.0 36 86.5 37 93.0 38 126.5 39 174.5 40 209.0 41 215.0 42 240.0 43 253.0 44 270.0 45 286.0 46 279.0 47 248.5 48 225.5 49 202.5 50 158.5 51 134.5 52 105.0 53 82.5 54 59.0 55 37.0 56 30.5 57 30.0 58 21.5 59 17.5 60 17.5 61 15.0 62 11.5 63 9.5 64 8.5 65 5.5 66 5.0 67 4.0 68 6.0 69 7.0 70 4.5 71 3.0 72 1.0 73 1.5 74 1.5 75 0.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.025 34-35 0.0125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59432048681542 98.2 2 0.3042596348884381 0.6 3 0.05070993914807302 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02535496957403651 0.22499999999999998 >10 0.02535496957403651 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 33 0.8250000000000001 TruSeq Adapter, Index 15 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTA 9 0.22499999999999998 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.225 0.0 0.0 0.0 0.0 2 0.225 0.0 0.0 0.0 0.0 3 0.225 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10-11 0.25 0.0 0.0 0.0 0.0 12-13 0.25 0.0 0.0 0.0 0.0 14-15 0.25 0.0 0.0 0.0 0.0 16-17 0.25 0.0 0.0 0.0 0.0 18-19 0.275 0.0 0.0 0.0 0.0 20-21 0.275 0.0 0.0 0.0 0.0 22-23 0.275 0.0 0.0 0.0 0.0 24-25 0.275 0.0 0.0 0.0 0.0 26-27 0.275 0.0 0.0 0.0 0.0 28-29 0.275 0.0 0.0 0.0 0.0 30-31 0.275 0.0 0.0 0.0 0.0 32-33 0.2875 0.0 0.0 0.0 0.0 34-35 0.3 0.0 0.0 0.0 0.0 36-37 0.3 0.0 0.0 0.0 0.0 38-39 0.3 0.0 0.0 0.0 0.0 40-41 0.3 0.0 0.0 0.0 0.0 42-43 0.325 0.0 0.0 0.0 0.0 44-45 0.325 0.0 0.0 0.0 0.0 46-47 0.325 0.0 0.0 0.0 0.0 48-49 0.325 0.0 0.0 0.0 0.0 50-51 0.325 0.0 0.0 0.0 0.0 52-53 0.325 0.0 0.0 0.0 0.0 54-55 0.325 0.0 0.0 0.0 0.0 56-57 0.35 0.0 0.0 0.0 0.0 58-59 0.35 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.4 0.0 0.0 0.0 0.0 66-67 0.4375 0.0 0.0 0.0 0.0 68-69 0.4625 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.4874999999999998 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.4875 0.0 0.0 0.0 0.0 104-105 3.0 0.0 0.0 0.0 0.0 106-107 3.6875 0.0 0.0 0.0 0.0 108-109 4.3125 0.0 0.0 0.0 0.0 110-111 4.9875 0.0 0.0 0.0 0.0 112-113 6.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCTC 15 2.507906E-4 118.9875 2 >>END_MODULE Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725040 spots for SRR3208053.sra Written 725040 spots for SRR3208053.sra Read 725056 spots for SRR3208053.sra Written 725056 spots for SRR3208053.sra SRR ids: ['SRR3208053.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7ni4ecph SRR3208053.sra spots: 14500816 blocks: [[1, 725040], [725041, 1450080], [1450081, 2175120], [2175121, 2900160], [2900161, 3625200], [3625201, 4350240], [4350241, 5075280], [5075281, 5800320], [5800321, 6525360], [6525361, 7250400], [7250401, 7975440], [7975441, 8700480], [8700481, 9425520], [9425521, 10150560], [10150561, 10875600], [10875601, 11600640], [11600641, 12325680], [12325681, 13050720], [13050721, 13775760], [13775761, 14500816]] SRR3208053 file size 4640976 SRR3208053 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208053 SRR3208053_1.fastq Input file: SRR3208053_1.fastq trimmed: SRR3208053-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:16:04 2025 >> started Wed Feb 12 04:16:15 2025 >> done (11.507s) 14500816 reads processed; of these: 18315 ( 0.13%) short reads filtered out after trimming by size control 197369 ( 1.36%) empty reads filtered out after trimming by size control 14285132 (98.51%) reads available; of these: 1589726 (11.13%) trimmed reads available after processing 12695406 (88.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 680 0.00% 19 699 0.00% 20 799 0.01% 21 715 0.01% 22 809 0.01% 23 839 0.01% 24 892 0.01% 25 1008 0.01% 26 960 0.01% 27 896 0.01% 28 989 0.01% 29 1035 0.01% 30 1413 0.01% 31 1380 0.01% 32 1235 0.01% 33 1185 0.01% 34 913 0.01% 35 903 0.01% 36 900 0.01% 37 933 0.01% 38 911 0.01% 39 909 0.01% 40 1325 0.01% 41 929 0.01% 42 996 0.01% 43 987 0.01% 44 917 0.01% 45 974 0.01% 46 941 0.01% 47 1002 0.01% 48 984 0.01% 49 1064 0.01% 50 1065 0.01% 51 1130 0.01% 52 1112 0.01% 53 1126 0.01% 54 1153 0.01% 55 1190 0.01% 56 1211 0.01% 57 1290 0.01% 58 1355 0.01% 59 1357 0.01% 60 1420 0.01% 61 1492 0.01% 62 1512 0.01% 63 1646 0.01% 64 2004 0.01% 65 8622 0.06% 66 2312 0.02% 67 1907 0.01% 68 1860 0.01% 69 1968 0.01% 70 2069 0.01% 71 2181 0.02% 72 2354 0.02% 73 2537 0.02% 74 3014 0.02% 75 3722 0.03% 76 5152 0.04% 77 3827 0.03% 78 3302 0.02% 79 3583 0.03% 80 3953 0.03% 81 4372 0.03% 82 5062 0.04% 83 5630 0.04% 84 5962 0.04% 85 6327 0.04% 86 6937 0.05% 87 7480 0.05% 88 8370 0.06% 89 9314 0.07% 90 10966 0.08% 91 12689 0.09% 92 14007 0.10% 93 15605 0.11% 94 2189 0.02% 95 2324 0.02% 96 2352 0.02% 97 2646 0.02% 98 2675 0.02% 99 2772 0.02% 100 3045 0.02% 101 3167 0.02% 102 3355 0.02% 103 3481 0.02% 104 3651 0.03% 105 3951 0.03% 106 4056 0.03% 107 4572 0.03% 108 4959 0.03% 109 5472 0.04% 110 6056 0.04% 111 6606 0.05% 112 7364 0.05% 113 8206 0.06% 114 9508 0.07% 115 10846 0.08% 116 12573 0.09% 117 15097 0.11% 118 18960 0.13% 119 24849 0.17% 120 31896 0.22% 121 44199 0.31% 122 76317 0.53% 123 212148 1.49% 124 834165 5.84% 125 12695406 88.87% 14285132 reads passed initial QC criterion=sequence-density sequence-density=5.09 sequence-density-rank=1 fanout-score=47.57 fanout-score-rank=1 prefix-density=6.82 prefix-fanout=35.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=5.09 sequence-density-rank=1 fanout-score=47.57 fanout-score-rank=1 prefix-density=6.82 prefix-fanout=35.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208053 - Input file: STDIN trimmed: SRR3208053-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:16:56 2025 >> started Wed Feb 12 04:17:08 2025 >> done (12.284s) 9523421 reads processed; of these: 467 ( 0.00%) short reads filtered out after trimming by size control 10790 ( 0.11%) empty reads filtered out after trimming by size control 9512164 (99.88%) reads available; of these: 1379910 (14.51%) trimmed reads available after processing 8132254 (85.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 479 0.01% 19 479 0.01% 20 534 0.01% 21 467 0.00% 22 552 0.01% 23 553 0.01% 24 598 0.01% 25 709 0.01% 26 643 0.01% 27 595 0.01% 28 646 0.01% 29 701 0.01% 30 975 0.01% 31 927 0.01% 32 856 0.01% 33 934 0.01% 34 613 0.01% 35 619 0.01% 36 624 0.01% 37 599 0.01% 38 612 0.01% 39 599 0.01% 40 1085 0.01% 41 643 0.01% 42 697 0.01% 43 691 0.01% 44 623 0.01% 45 660 0.01% 46 643 0.01% 47 693 0.01% 48 661 0.01% 49 690 0.01% 50 724 0.01% 51 725 0.01% 52 719 0.01% 53 726 0.01% 54 777 0.01% 55 839 0.01% 56 826 0.01% 57 855 0.01% 58 848 0.01% 59 952 0.01% 60 953 0.01% 61 995 0.01% 62 976 0.01% 63 1045 0.01% 64 1000 0.01% 65 1067 0.01% 66 1129 0.01% 67 1180 0.01% 68 1241 0.01% 69 1308 0.01% 70 1319 0.01% 71 1440 0.02% 72 1510 0.02% 73 1574 0.02% 74 1701 0.02% 75 1680 0.02% 76 1811 0.02% 77 2026 0.02% 78 2138 0.02% 79 2323 0.02% 80 2674 0.03% 81 2928 0.03% 82 3394 0.04% 83 3690 0.04% 84 3954 0.04% 85 4206 0.04% 86 4630 0.05% 87 4987 0.05% 88 5613 0.06% 89 6290 0.07% 90 7285 0.08% 91 8052 0.08% 92 9196 0.10% 93 10563 0.11% 94 11952 0.13% 95 12866 0.14% 96 13742 0.14% 97 14830 0.16% 98 16619 0.17% 99 18465 0.19% 100 20672 0.22% 101 23465 0.25% 102 26205 0.28% 103 29429 0.31% 104 31582 0.33% 105 33569 0.35% 106 34934 0.37% 107 37167 0.39% 108 39437 0.41% 109 42278 0.44% 110 45234 0.48% 111 49689 0.52% 112 54703 0.58% 113 59308 0.62% 114 63094 0.66% 115 66525 0.70% 116 68510 0.72% 117 70444 0.74% 118 74506 0.78% 119 81982 0.86% 120 99344 1.04% 121 141522 1.49% 122 293670 3.09% 123 124180 1.31% 124 491672 5.17% 125 7185300 75.54% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=4.86 fanout-score-rank=21 prefix-density=0.10 prefix-fanout=3.2 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=274.51 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=28.1 sequence=CTTCTTCTTCTT Started job on | Feb 12 04:17:34 Started mapping on | Feb 12 04:17:34 Finished on | Feb 12 04:18:01 Mapping speed, Million of reads per hour | 1903.18 Number of input reads | 14273875 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 13055478 Uniquely mapped reads % | 91.46% Average mapped length | 122.27 Number of splices: Total | 4938917 Number of splices: Annotated (sjdb) | 4841784 Number of splices: GT/AG | 4862631 Number of splices: GC/AG | 62379 Number of splices: AT/AC | 5184 Number of splices: Non-canonical | 8723 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284968 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 456047 % of reads mapped to too many loci | 3.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 933429 933429 933429 N_multimapping 284968 284968 284968 N_noFeature 560722 6764337 6767222 N_ambiguous 132898 24123 24362 UnstrandedReadsAssigned:12361858 PositiveStrandReadsAssigned:6267018 NegativeStrandReadsAssigned:6263894 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208053 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208053-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,273,875 reads, 12,996,068 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52401 SRR3208053.ke.tsv 34699 SRR3208053.se.tsv 87100 total ==> SRR3208053.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 555 31.7001 Potri.005G024800.1.v4.1 1035 936 89 10.4221 Potri.004G059700.1.v4.1 961 862 27 3.4332 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 208.337 8.02933 Potri.016G087400.1.v4.1 270 171 531 340.362 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 49.4656 3.23885 Potri.012G127500.1.v4.1 977 878 2267 283.008 ==> SRR3208053.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1236 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3208053 completed mapping pipeline successfully