Starting /dee2/code/volunteer_pipeline.sh SRR3208054 current disk space = 3049186897920 free memory = 1358187416 SRR3208054 SRAfilesize 57dd1e65e384f742acab2bee8da324b1 SRR3208054.sra SRR3208054.sra file validated SRR3208054 is single end SRR3208054 is conventional basespace SRR3208054 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208054_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.27 33.0 33.0 33.0 33.0 33.0 2 32.1495 33.0 33.0 33.0 33.0 33.0 3 32.2635 33.0 33.0 33.0 33.0 33.0 4 32.37725 33.0 33.0 33.0 33.0 33.0 5 32.404 33.0 33.0 33.0 33.0 33.0 6 36.1305 37.0 37.0 37.0 37.0 37.0 7 36.22 37.0 37.0 37.0 37.0 37.0 8 36.20825 37.0 37.0 37.0 37.0 37.0 9 36.279 37.0 37.0 37.0 37.0 37.0 10-11 36.343875 37.0 37.0 37.0 37.0 37.0 12-13 36.345625 37.0 37.0 37.0 37.0 37.0 14-15 36.323125000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.31375 37.0 37.0 37.0 37.0 37.0 18-19 36.297875000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.321 37.0 37.0 37.0 37.0 37.0 22-23 36.261624999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.323375 37.0 37.0 37.0 37.0 37.0 26-27 36.199 37.0 37.0 37.0 37.0 37.0 28-29 36.220375 37.0 37.0 37.0 37.0 37.0 30-31 36.24025 37.0 37.0 37.0 37.0 37.0 32-33 36.214625 37.0 37.0 37.0 37.0 37.0 34-35 36.1995 37.0 37.0 37.0 37.0 37.0 36-37 36.227625 37.0 37.0 37.0 37.0 37.0 38-39 36.20125 37.0 37.0 37.0 37.0 37.0 40-41 36.204375 37.0 37.0 37.0 37.0 37.0 42-43 36.221374999999995 37.0 37.0 37.0 37.0 37.0 44-45 36.207 37.0 37.0 37.0 37.0 37.0 46-47 36.194500000000005 37.0 37.0 37.0 37.0 37.0 48-49 36.2445 37.0 37.0 37.0 37.0 37.0 50-51 36.182 37.0 37.0 37.0 37.0 37.0 52-53 36.214375000000004 37.0 37.0 37.0 37.0 37.0 54-55 36.233625 37.0 37.0 37.0 37.0 37.0 56-57 36.236875 37.0 37.0 37.0 37.0 37.0 58-59 36.10725 37.0 37.0 37.0 37.0 37.0 60-61 36.129625000000004 37.0 37.0 37.0 37.0 37.0 62-63 36.1255 37.0 37.0 37.0 37.0 37.0 64-65 36.153875 37.0 37.0 37.0 37.0 37.0 66-67 36.129999999999995 37.0 37.0 37.0 37.0 37.0 68-69 36.171875 37.0 37.0 37.0 37.0 37.0 70-71 36.119125 37.0 37.0 37.0 37.0 37.0 72-73 36.11925 37.0 37.0 37.0 37.0 37.0 74-75 36.10625 37.0 37.0 37.0 37.0 37.0 76-77 36.06425 37.0 37.0 37.0 37.0 37.0 78-79 36.084500000000006 37.0 37.0 37.0 37.0 37.0 80-81 36.103 37.0 37.0 37.0 37.0 37.0 82-83 36.129374999999996 37.0 37.0 37.0 37.0 37.0 84-85 36.05675 37.0 37.0 37.0 37.0 37.0 86-87 35.994625 37.0 37.0 37.0 37.0 37.0 88-89 36.019 37.0 37.0 37.0 37.0 37.0 90-91 35.908625 37.0 37.0 37.0 37.0 37.0 92-93 35.87125 37.0 37.0 37.0 37.0 37.0 94-95 35.87475 37.0 37.0 37.0 37.0 37.0 96-97 35.851625 37.0 37.0 37.0 37.0 37.0 98-99 35.89775 37.0 37.0 37.0 37.0 37.0 100-101 35.865875 37.0 37.0 37.0 37.0 37.0 102-103 35.829125000000005 37.0 37.0 37.0 37.0 37.0 104-105 35.7735 37.0 37.0 37.0 37.0 37.0 106-107 35.801249999999996 37.0 37.0 37.0 37.0 37.0 108-109 35.780625 37.0 37.0 37.0 37.0 37.0 110-111 35.730625 37.0 37.0 37.0 37.0 37.0 112-113 35.658625 37.0 37.0 37.0 37.0 37.0 114-115 35.601625 37.0 37.0 37.0 37.0 37.0 116-117 35.543125 37.0 37.0 37.0 37.0 37.0 118-119 35.572625 37.0 37.0 37.0 37.0 37.0 120-121 35.514375 37.0 37.0 37.0 37.0 37.0 122-123 35.4345 37.0 37.0 37.0 37.0 37.0 124-125 33.897875 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 4.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 3.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 2.0 18 1.0 19 1.0 20 1.0 21 7.0 22 5.0 23 3.0 24 7.0 25 8.0 26 11.0 27 12.0 28 13.0 29 32.0 30 46.0 31 36.0 32 43.0 33 90.0 34 129.0 35 238.0 36 3287.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.110766045548655 14.98447204968944 12.39648033126294 49.50828157349896 2 17.25 23.05 40.65 19.05 3 20.849999999999998 26.35 27.425 25.374999999999996 4 23.425 31.025000000000002 21.325 24.224999999999998 5 24.4 34.25 23.474999999999998 17.875 6 19.325 37.7 23.799999999999997 19.175 7 15.925 18.3 44.175 21.6 8 19.129782445611404 23.455863965991497 30.732683170792697 26.6816704176044 9 18.35 24.525 32.95 24.175 10-11 21.9625 33.4 23.1 21.5375 12-13 20.150000000000002 26.937499999999996 29.799999999999997 23.1125 14-15 20.625 27.437499999999996 28.475 23.4625 16-17 21.425 27.712500000000002 28.4125 22.45 18-19 21.224999999999998 28.775000000000002 27.200000000000003 22.8 20-21 22.35 27.3375 28.6875 21.625 22-23 21.55 28.712500000000002 27.1375 22.6 24-25 21.65 28.9 28.199999999999996 21.25 26-27 22.268067016754188 29.03225806451613 27.219304826206553 21.48037009252313 28-29 21.895710891584343 28.83581343003626 27.72289608603226 21.54557959234713 30-31 20.99799899949975 29.48974487243622 27.913956978489246 21.59829914957479 32-33 21.834334334334336 29.041541541541545 27.27727727727728 21.846846846846844 34-35 21.61621215911934 28.458844133099824 28.383787840880657 21.541155866900176 36-37 21.508065524571716 28.473177441540575 28.648243091159188 21.370513942728522 38-39 21.65 28.262500000000003 28.462500000000002 21.625 40-41 21.9625 27.1125 28.599999999999998 22.325 42-43 21.349999999999998 28.9125 28.1625 21.575 44-45 21.212500000000002 29.5 27.825 21.462500000000002 46-47 22.675 27.825 27.962500000000002 21.5375 48-49 21.475 28.849999999999998 27.675 22.0 50-51 21.725 28.6625 28.487499999999997 21.125 52-53 22.3 28.1375 27.825 21.7375 54-55 21.025 27.875 28.4125 22.6875 56-57 22.425 27.725 28.1125 21.7375 58-59 21.975 29.125 27.487499999999997 21.4125 60-61 21.9375 28.025 27.787499999999998 22.25 62-63 21.587500000000002 28.5625 28.499999999999996 21.349999999999998 64-65 22.45 27.450000000000003 28.537499999999998 21.5625 66-67 22.025 28.225 28.175 21.575 68-69 21.087500000000002 28.762500000000003 28.512500000000003 21.637500000000003 70-71 21.6 28.4 28.1 21.9 72-73 21.2875 28.8625 28.512500000000003 21.337500000000002 74-75 22.075 28.025 28.7375 21.1625 76-77 22.025 28.712500000000002 27.8875 21.375 78-79 22.0125 27.525 28.725 21.7375 80-81 22.8 27.5875 28.6875 20.925 82-83 21.9375 29.175 27.750000000000004 21.1375 84-85 22.037499999999998 28.449999999999996 28.249999999999996 21.2625 86-87 22.6875 28.499999999999996 28.050000000000004 20.7625 88-89 22.425 27.8625 28.275 21.4375 90-91 21.85 27.987499999999997 28.15 22.0125 92-93 22.6125 28.349999999999998 27.075 21.9625 94-95 22.412499999999998 27.462500000000002 27.8875 22.237499999999997 96-97 21.7375 29.5 27.437499999999996 21.325 98-99 21.762500000000003 29.7 28.050000000000004 20.4875 100-101 21.8625 27.800000000000004 27.737499999999997 22.6 102-103 21.75 27.8375 28.712500000000002 21.7 104-105 22.1375 28.375 28.1 21.3875 106-107 22.725 28.262500000000003 28.075 20.9375 108-109 21.987499999999997 28.5625 27.6875 21.762500000000003 110-111 22.425 27.474999999999998 28.349999999999998 21.75 112-113 23.4375 28.599999999999998 26.5375 21.425 114-115 21.675 29.525000000000002 26.450000000000003 22.35 116-117 22.3375 28.787499999999998 27.375 21.5 118-119 22.025 28.975 27.0 22.0 120-121 23.400000000000002 28.549999999999997 25.6 22.45 122-123 23.6375 28.599999999999998 26.5125 21.25 124-125 22.8375 29.049999999999997 26.7125 21.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 3.0 24 3.0 25 4.5 26 6.5 27 5.0 28 9.0 29 20.0 30 24.0 31 28.5 32 33.0 33 46.5 34 58.5 35 75.0 36 100.5 37 124.0 38 151.5 39 164.0 40 188.0 41 214.5 42 245.5 43 289.5 44 282.0 45 275.0 46 278.5 47 248.5 48 225.0 49 190.5 50 160.5 51 129.5 52 93.5 53 77.0 54 59.0 55 41.5 56 33.0 57 23.5 58 12.0 59 9.0 60 9.5 61 9.5 62 7.5 63 7.0 64 6.0 65 2.5 66 3.5 67 3.5 68 2.0 69 2.5 70 3.0 71 2.5 72 1.0 73 1.0 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.0375 30-31 0.05 32-33 0.1 34-35 0.075 36-37 0.0375 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.2750000000000004 0.0 0.0 0.0 0.0 106-107 2.9124999999999996 0.0 0.0 0.0 0.0 108-109 3.5625 0.0 0.0 0.0 0.0 110-111 4.2875 0.0 0.0 0.0 0.0 112-113 5.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034747 spots for SRR3208054.sra Written 1034747 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra Read 1034739 spots for SRR3208054.sra Written 1034739 spots for SRR3208054.sra SRR ids: ['SRR3208054.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0r_bho6w SRR3208054.sra spots: 20694788 blocks: [[1, 1034739], [1034740, 2069478], [2069479, 3104217], [3104218, 4138956], [4138957, 5173695], [5173696, 6208434], [6208435, 7243173], [7243174, 8277912], [8277913, 9312651], [9312652, 10347390], [10347391, 11382129], [11382130, 12416868], [12416869, 13451607], [13451608, 14486346], [14486347, 15521085], [15521086, 16555824], [16555825, 17590563], [17590564, 18625302], [18625303, 19660041], [19660042, 20694788]] SRR3208054 file size 6627984 SRR3208054 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208054 SRR3208054_1.fastq Input file: SRR3208054_1.fastq trimmed: SRR3208054-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:29:57 2025 >> started Wed Feb 12 04:30:08 2025 >> done (10.954s) 20694788 reads processed; of these: 16020 ( 0.08%) short reads filtered out after trimming by size control 70719 ( 0.34%) empty reads filtered out after trimming by size control 20608049 (99.58%) reads available; of these: 2375234 (11.53%) trimmed reads available after processing 18232815 (88.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 730 0.00% 19 753 0.00% 20 1193 0.01% 21 784 0.00% 22 893 0.00% 23 992 0.00% 24 1097 0.01% 25 1359 0.01% 26 1311 0.01% 27 1184 0.01% 28 1197 0.01% 29 1384 0.01% 30 2076 0.01% 31 2604 0.01% 32 1261 0.01% 33 1127 0.01% 34 1100 0.01% 35 1086 0.01% 36 1111 0.01% 37 1259 0.01% 38 1151 0.01% 39 1129 0.01% 40 1168 0.01% 41 1247 0.01% 42 1197 0.01% 43 1258 0.01% 44 1315 0.01% 45 1268 0.01% 46 1256 0.01% 47 1344 0.01% 48 1271 0.01% 49 1359 0.01% 50 1390 0.01% 51 1440 0.01% 52 1443 0.01% 53 1476 0.01% 54 1476 0.01% 55 1512 0.01% 56 1510 0.01% 57 1659 0.01% 58 1770 0.01% 59 1718 0.01% 60 1798 0.01% 61 1859 0.01% 62 1939 0.01% 63 1961 0.01% 64 1935 0.01% 65 2015 0.01% 66 2085 0.01% 67 2129 0.01% 68 2209 0.01% 69 2368 0.01% 70 2479 0.01% 71 2757 0.01% 72 2807 0.01% 73 3006 0.01% 74 3278 0.02% 75 3473 0.02% 76 3522 0.02% 77 3624 0.02% 78 3986 0.02% 79 4483 0.02% 80 4940 0.02% 81 5540 0.03% 82 6223 0.03% 83 7059 0.03% 84 7435 0.04% 85 8073 0.04% 86 8719 0.04% 87 9675 0.05% 88 10942 0.05% 89 12399 0.06% 90 14322 0.07% 91 16535 0.08% 92 18817 0.09% 93 20877 0.10% 94 3428 0.02% 95 3536 0.02% 96 3792 0.02% 97 4057 0.02% 98 3969 0.02% 99 4230 0.02% 100 4463 0.02% 101 4601 0.02% 102 4903 0.02% 103 5064 0.02% 104 5330 0.03% 105 5684 0.03% 106 6149 0.03% 107 6675 0.03% 108 7338 0.04% 109 8010 0.04% 110 8871 0.04% 111 9966 0.05% 112 11109 0.05% 113 12290 0.06% 114 14265 0.07% 115 16448 0.08% 116 19121 0.09% 117 23369 0.11% 118 29012 0.14% 119 38795 0.19% 120 49980 0.24% 121 69785 0.34% 122 120966 0.59% 123 327820 1.59% 124 1282081 6.22% 125 18232815 88.47% 20608049 reads passed initial QC criterion=sequence-density sequence-density=4.73 sequence-density-rank=1 fanout-score=46.89 fanout-score-rank=1 prefix-density=6.43 prefix-fanout=34.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=4.73 sequence-density-rank=1 fanout-score=46.89 fanout-score-rank=1 prefix-density=6.43 prefix-fanout=34.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208054 - Input file: STDIN trimmed: SRR3208054-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:31:17 2025 >> started Wed Feb 12 04:31:31 2025 >> done (13.299s) 12364830 reads processed; of these: 189 ( 0.00%) short reads filtered out after trimming by size control 496 ( 0.00%) empty reads filtered out after trimming by size control 12364145 (99.99%) reads available; of these: 1720853 (13.92%) trimmed reads available after processing 10643292 (86.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 430 0.00% 19 454 0.00% 20 1192 0.01% 21 482 0.00% 22 538 0.00% 23 619 0.01% 24 644 0.01% 25 833 0.01% 26 802 0.01% 27 694 0.01% 28 737 0.01% 29 823 0.01% 30 1183 0.01% 31 1588 0.01% 32 760 0.01% 33 673 0.01% 34 668 0.01% 35 630 0.01% 36 686 0.01% 37 792 0.01% 38 655 0.01% 39 710 0.01% 40 714 0.01% 41 758 0.01% 42 729 0.01% 43 744 0.01% 44 797 0.01% 45 789 0.01% 46 777 0.01% 47 813 0.01% 48 773 0.01% 49 833 0.01% 50 803 0.01% 51 865 0.01% 52 872 0.01% 53 905 0.01% 54 874 0.01% 55 904 0.01% 56 924 0.01% 57 1037 0.01% 58 1076 0.01% 59 1022 0.01% 60 1109 0.01% 61 1097 0.01% 62 1145 0.01% 63 1146 0.01% 64 1167 0.01% 65 1195 0.01% 66 1240 0.01% 67 1287 0.01% 68 1331 0.01% 69 1428 0.01% 70 1491 0.01% 71 1674 0.01% 72 1680 0.01% 73 1781 0.01% 74 1922 0.02% 75 1904 0.02% 76 2021 0.02% 77 2109 0.02% 78 2488 0.02% 79 2764 0.02% 80 3028 0.02% 81 3368 0.03% 82 3670 0.03% 83 4209 0.03% 84 4448 0.04% 85 4892 0.04% 86 5262 0.04% 87 5882 0.05% 88 6656 0.05% 89 7479 0.06% 90 8631 0.07% 91 9805 0.08% 92 11281 0.09% 93 12660 0.10% 94 14294 0.12% 95 15502 0.13% 96 16649 0.13% 97 18102 0.15% 98 20068 0.16% 99 22326 0.18% 100 25338 0.20% 101 28476 0.23% 102 32336 0.26% 103 35818 0.29% 104 39055 0.32% 105 42131 0.34% 106 43675 0.35% 107 45578 0.37% 108 47295 0.38% 109 51071 0.41% 110 56258 0.46% 111 61640 0.50% 112 68565 0.55% 113 73745 0.60% 114 79875 0.65% 115 83496 0.68% 116 86935 0.70% 117 90190 0.73% 118 94754 0.77% 119 104833 0.85% 120 128840 1.04% 121 186018 1.50% 122 384613 3.11% 123 175242 1.42% 124 687564 5.56% 125 9347011 75.60% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=76.49 fanout-score-rank=9 prefix-density=0.27 prefix-fanout=17.0 sequence=TTCTTTCTTTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=46 fanout-score=408.93 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=16.7 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGA Started job on | Feb 12 04:31:58 Started mapping on | Feb 12 04:31:58 Finished on | Feb 12 04:32:29 Mapping speed, Million of reads per hour | 2393.11 Number of input reads | 20607364 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 19595033 Uniquely mapped reads % | 95.09% Average mapped length | 122.37 Number of splices: Total | 7141586 Number of splices: Annotated (sjdb) | 7001413 Number of splices: GT/AG | 7033150 Number of splices: GC/AG | 87871 Number of splices: AT/AC | 7340 Number of splices: Non-canonical | 13225 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405324 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 192874 % of reads mapped to too many loci | 0.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 607007 607007 607007 N_multimapping 405324 405324 405324 N_noFeature 862069 10153293 10158206 N_ambiguous 216321 35043 36104 UnstrandedReadsAssigned:18516643 PositiveStrandReadsAssigned:9406697 NegativeStrandReadsAssigned:9400723 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208054 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208054-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,607,364 reads, 19,030,318 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR3208054.ke.tsv 34699 SRR3208054.se.tsv 87100 total ==> SRR3208054.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 693 27.1766 Potri.005G024800.1.v4.1 1035 936 83 6.67328 Potri.004G059700.1.v4.1 961 862 39 3.40482 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 276 7.30326 Potri.016G087400.1.v4.1 270 171 853 375.397 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 75 3.37165 Potri.012G127500.1.v4.1 977 878 3614 309.764 ==> SRR3208054.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2223 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 391 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 42 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3208054 completed mapping pipeline successfully