Starting /dee2/code/volunteer_pipeline.sh SRR3208055 current disk space = 3049052508160 free memory = 1578873784 SRR3208055 SRAfilesize fada20e55bcc0868be3487f1a2be9af7 SRR3208055.sra SRR3208055.sra file validated SRR3208055 is single end SRR3208055 is conventional basespace SRR3208055 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208055_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.91275 33.0 33.0 33.0 27.0 33.0 2 31.96725 33.0 33.0 33.0 33.0 33.0 3 32.1465 33.0 33.0 33.0 33.0 33.0 4 32.28275 33.0 33.0 33.0 33.0 33.0 5 32.27725 33.0 33.0 33.0 33.0 33.0 6 36.045 37.0 37.0 37.0 37.0 37.0 7 36.11225 37.0 37.0 37.0 37.0 37.0 8 36.1125 37.0 37.0 37.0 37.0 37.0 9 36.1475 37.0 37.0 37.0 37.0 37.0 10-11 36.194 37.0 37.0 37.0 37.0 37.0 12-13 36.217875 37.0 37.0 37.0 37.0 37.0 14-15 36.11425 37.0 37.0 37.0 37.0 37.0 16-17 36.169875000000005 37.0 37.0 37.0 37.0 37.0 18-19 36.21225 37.0 37.0 37.0 37.0 37.0 20-21 36.24225 37.0 37.0 37.0 37.0 37.0 22-23 36.179249999999996 37.0 37.0 37.0 37.0 37.0 24-25 36.161 37.0 37.0 37.0 37.0 37.0 26-27 36.082625 37.0 37.0 37.0 37.0 37.0 28-29 36.15375 37.0 37.0 37.0 37.0 37.0 30-31 36.140625 37.0 37.0 37.0 37.0 37.0 32-33 36.181375 37.0 37.0 37.0 37.0 37.0 34-35 36.164 37.0 37.0 37.0 37.0 37.0 36-37 36.116125 37.0 37.0 37.0 37.0 37.0 38-39 36.12875 37.0 37.0 37.0 37.0 37.0 40-41 36.1105 37.0 37.0 37.0 37.0 37.0 42-43 36.10525 37.0 37.0 37.0 37.0 37.0 44-45 36.127250000000004 37.0 37.0 37.0 37.0 37.0 46-47 36.104 37.0 37.0 37.0 37.0 37.0 48-49 36.077375 37.0 37.0 37.0 37.0 37.0 50-51 36.085125000000005 37.0 37.0 37.0 37.0 37.0 52-53 36.073750000000004 37.0 37.0 37.0 37.0 37.0 54-55 36.07275 37.0 37.0 37.0 37.0 37.0 56-57 36.087875 37.0 37.0 37.0 37.0 37.0 58-59 36.040000000000006 37.0 37.0 37.0 37.0 37.0 60-61 36.05675 37.0 37.0 37.0 37.0 37.0 62-63 36.026624999999996 37.0 37.0 37.0 37.0 37.0 64-65 36.0055 37.0 37.0 37.0 37.0 37.0 66-67 35.994875 37.0 37.0 37.0 37.0 37.0 68-69 35.985625 37.0 37.0 37.0 37.0 37.0 70-71 36.02175 37.0 37.0 37.0 37.0 37.0 72-73 36.002875 37.0 37.0 37.0 37.0 37.0 74-75 35.91775 37.0 37.0 37.0 37.0 37.0 76-77 35.861625000000004 37.0 37.0 37.0 37.0 37.0 78-79 35.885374999999996 37.0 37.0 37.0 37.0 37.0 80-81 35.754000000000005 37.0 37.0 37.0 37.0 37.0 82-83 35.85125 37.0 37.0 37.0 37.0 37.0 84-85 35.841625 37.0 37.0 37.0 37.0 37.0 86-87 35.789 37.0 37.0 37.0 37.0 37.0 88-89 35.773624999999996 37.0 37.0 37.0 37.0 37.0 90-91 35.789625 37.0 37.0 37.0 37.0 37.0 92-93 35.746375 37.0 37.0 37.0 37.0 37.0 94-95 35.72025 37.0 37.0 37.0 37.0 37.0 96-97 35.664625 37.0 37.0 37.0 37.0 37.0 98-99 35.7095 37.0 37.0 37.0 37.0 37.0 100-101 35.615750000000006 37.0 37.0 37.0 37.0 37.0 102-103 35.558375 37.0 37.0 37.0 37.0 37.0 104-105 35.603625 37.0 37.0 37.0 37.0 37.0 106-107 35.6285 37.0 37.0 37.0 37.0 37.0 108-109 35.5385 37.0 37.0 37.0 37.0 37.0 110-111 35.562124999999995 37.0 37.0 37.0 37.0 37.0 112-113 35.435375 37.0 37.0 37.0 35.0 37.0 114-115 35.5595 37.0 37.0 37.0 37.0 37.0 116-117 35.436875 37.0 37.0 37.0 37.0 37.0 118-119 35.420125 37.0 37.0 37.0 37.0 37.0 120-121 35.372 37.0 37.0 37.0 35.0 37.0 122-123 35.32825 37.0 37.0 37.0 37.0 37.0 124-125 33.718625 37.0 35.0 37.0 27.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 3.0 9 1.0 10 1.0 11 1.0 12 1.0 13 3.0 14 0.0 15 0.0 16 6.0 17 2.0 18 0.0 19 5.0 20 4.0 21 1.0 22 10.0 23 1.0 24 1.0 25 4.0 26 9.0 27 13.0 28 14.0 29 21.0 30 36.0 31 44.0 32 57.0 33 76.0 34 126.0 35 232.0 36 3291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.31081081081081 15.722453222453222 10.187110187110187 50.77962577962578 2 18.525 20.925 40.8 19.75 3 19.575 24.95 28.549999999999997 26.924999999999997 4 23.325000000000003 31.15 21.575 23.95 5 25.650000000000002 35.0 20.724999999999998 18.625 6 20.175 35.8 25.15 18.875 7 17.625 19.650000000000002 43.15 19.575 8 18.35 24.75 30.275000000000002 26.625 9 19.650000000000002 22.975 33.125 24.25 10-11 22.35 32.8125 24.05 20.7875 12-13 19.9125 27.8625 29.2 23.025000000000002 14-15 20.549999999999997 27.900000000000002 28.5875 22.9625 16-17 22.5625 28.125 27.275 22.037499999999998 18-19 21.775 28.075 28.0875 22.0625 20-21 21.4875 27.875 27.6125 23.025000000000002 22-23 22.1 28.375 27.462500000000002 22.0625 24-25 22.175 28.1625 27.224999999999998 22.4375 26-27 22.125 27.987499999999997 27.987499999999997 21.9 28-29 21.525 28.65 28.125 21.7 30-31 21.6875 28.262500000000003 27.6375 22.412499999999998 32-33 21.742935733933482 28.907226806701676 27.44436109027257 21.905476369092273 34-35 22.165270658832352 27.82847855981998 27.65345668208526 22.352794099262407 36-37 21.965245655706962 28.178522315289413 26.990873859232405 22.86535816977122 38-39 22.675 28.825 27.150000000000002 21.349999999999998 40-41 21.8 28.3875 27.85 21.9625 42-43 22.412499999999998 28.512500000000003 27.3625 21.712500000000002 44-45 21.7 28.675 28.4375 21.1875 46-47 22.287499999999998 28.275 26.9125 22.525000000000002 48-49 21.05 28.7 28.037499999999998 22.2125 50-51 22.5875 27.5875 28.262500000000003 21.5625 52-53 21.3125 28.725 27.825 22.1375 54-55 21.7875 28.287499999999998 27.437499999999996 22.4875 56-57 22.3625 28.775000000000002 27.037499999999998 21.825 58-59 22.2125 28.1125 27.9125 21.762500000000003 60-61 23.1625 27.950000000000003 27.0875 21.8 62-63 21.45 29.275000000000002 27.8875 21.3875 64-65 21.7875 29.049999999999997 27.8125 21.349999999999998 66-67 22.05 28.3375 27.425 22.1875 68-69 21.65 28.749999999999996 27.35 22.25 70-71 22.0625 28.462500000000002 27.3625 22.112499999999997 72-73 21.55 28.9 27.650000000000002 21.9 74-75 21.712500000000002 27.6125 28.599999999999998 22.075 76-77 21.3875 28.3375 27.987499999999997 22.287499999999998 78-79 22.8625 27.237499999999997 28.175 21.725 80-81 21.725 28.5875 27.712500000000002 21.975 82-83 22.5625 27.125 27.700000000000003 22.6125 84-85 22.2625 27.6 28.3125 21.825 86-87 21.775 28.262500000000003 27.900000000000002 22.0625 88-89 21.475 28.3875 28.3375 21.8 90-91 22.25 28.025 27.487499999999997 22.237499999999997 92-93 22.162499999999998 27.762500000000003 28.0875 21.987499999999997 94-95 22.15 27.474999999999998 28.1125 22.2625 96-97 22.05 28.5625 27.35 22.037499999999998 98-99 21.9 28.199999999999996 28.487499999999997 21.4125 100-101 23.0875 28.6875 26.325 21.9 102-103 21.8625 28.1 27.375 22.662499999999998 104-105 22.8875 27.9375 27.075 22.1 106-107 22.6875 28.012500000000003 27.0125 22.287499999999998 108-109 21.725 29.4125 26.8625 22.0 110-111 22.05 27.675 28.037499999999998 22.237499999999997 112-113 22.075 28.462500000000002 27.85 21.6125 114-115 22.4875 28.15 27.6125 21.75 116-117 23.200000000000003 28.499999999999996 26.674999999999997 21.625 118-119 23.4125 28.6625 26.187500000000004 21.7375 120-121 22.8375 28.0875 26.437500000000004 22.6375 122-123 23.400000000000002 29.012500000000003 26.25 21.337500000000002 124-125 23.6625 28.15 26.424999999999997 21.762500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 1.0 25 2.5 26 5.5 27 9.5 28 8.5 29 9.0 30 19.5 31 28.0 32 33.0 33 43.5 34 54.0 35 68.5 36 84.0 37 109.5 38 142.0 39 172.0 40 201.5 41 224.5 42 243.0 43 262.0 44 277.5 45 271.0 46 249.5 47 243.0 48 229.5 49 191.0 50 167.0 51 141.5 52 104.0 53 82.5 54 68.5 55 58.0 56 47.0 57 30.0 58 19.0 59 14.0 60 12.0 61 10.5 62 11.0 63 8.0 64 4.5 65 3.5 66 3.5 67 5.5 68 5.0 69 3.5 70 2.0 71 1.0 72 2.0 73 2.0 74 1.5 75 1.5 76 0.5 77 0.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.025 34-35 0.0125 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84939759036145 99.45 2 0.12550200803212852 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0251004016064257 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 12 0.3 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.1 0.0 0.0 0.0 0.0 106-107 2.6624999999999996 0.0 0.0 0.0 0.0 108-109 3.275 0.0 0.0 0.0 0.0 110-111 3.8 0.0 0.0 0.0 0.0 112-113 4.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTGAT 15 0.0040863203 59.49375 98-99 >>END_MODULE Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435222 spots for SRR3208055.sra Written 1435222 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra Read 1435203 spots for SRR3208055.sra Written 1435203 spots for SRR3208055.sra SRR ids: ['SRR3208055.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dxecbl8t SRR3208055.sra spots: 28704079 blocks: [[1, 1435203], [1435204, 2870406], [2870407, 4305609], [4305610, 5740812], [5740813, 7176015], [7176016, 8611218], [8611219, 10046421], [10046422, 11481624], [11481625, 12916827], [12916828, 14352030], [14352031, 15787233], [15787234, 17222436], [17222437, 18657639], [18657640, 20092842], [20092843, 21528045], [21528046, 22963248], [22963249, 24398451], [24398452, 25833654], [25833655, 27268857], [27268858, 28704079]] SRR3208055 file size 9197348 SRR3208055 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208055 SRR3208055_1.fastq Input file: SRR3208055_1.fastq trimmed: SRR3208055-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:57:57 2025 >> started Wed Feb 12 04:58:18 2025 >> done (20.748s) 28704079 reads processed; of these: 24824 ( 0.09%) short reads filtered out after trimming by size control 236549 ( 0.82%) empty reads filtered out after trimming by size control 28442706 (99.09%) reads available; of these: 3272106 (11.50%) trimmed reads available after processing 25170600 (88.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1013 0.00% 19 1033 0.00% 20 1145 0.00% 21 1216 0.00% 22 1374 0.00% 23 1389 0.00% 24 1639 0.01% 25 1867 0.01% 26 1840 0.01% 27 1749 0.01% 28 1842 0.01% 29 1915 0.01% 30 2709 0.01% 31 2717 0.01% 32 1837 0.01% 33 1736 0.01% 34 1706 0.01% 35 1717 0.01% 36 1810 0.01% 37 1826 0.01% 38 1866 0.01% 39 1832 0.01% 40 1907 0.01% 41 1863 0.01% 42 1916 0.01% 43 1968 0.01% 44 2009 0.01% 45 2083 0.01% 46 2175 0.01% 47 2125 0.01% 48 2251 0.01% 49 2278 0.01% 50 2258 0.01% 51 2321 0.01% 52 2411 0.01% 53 2394 0.01% 54 2404 0.01% 55 2537 0.01% 56 2525 0.01% 57 2840 0.01% 58 2806 0.01% 59 2965 0.01% 60 3107 0.01% 61 3109 0.01% 62 3276 0.01% 63 3289 0.01% 64 3730 0.01% 65 4590 0.02% 66 3805 0.01% 67 3498 0.01% 68 3730 0.01% 69 4068 0.01% 70 4233 0.01% 71 4373 0.02% 72 4532 0.02% 73 4822 0.02% 74 5159 0.02% 75 6103 0.02% 76 6900 0.02% 77 6433 0.02% 78 6095 0.02% 79 6710 0.02% 80 7421 0.03% 81 8032 0.03% 82 8856 0.03% 83 9836 0.03% 84 10133 0.04% 85 11069 0.04% 86 11885 0.04% 87 13188 0.05% 88 14449 0.05% 89 16227 0.06% 90 18741 0.07% 91 21090 0.07% 92 24217 0.09% 93 26751 0.09% 94 4413 0.02% 95 4480 0.02% 96 4894 0.02% 97 5197 0.02% 98 5353 0.02% 99 5671 0.02% 100 6183 0.02% 101 6420 0.02% 102 6591 0.02% 103 6854 0.02% 104 7448 0.03% 105 7830 0.03% 106 8392 0.03% 107 9184 0.03% 108 9914 0.03% 109 11199 0.04% 110 12062 0.04% 111 13207 0.05% 112 14904 0.05% 113 17102 0.06% 114 19434 0.07% 115 22403 0.08% 116 26008 0.09% 117 31675 0.11% 118 39440 0.14% 119 52708 0.19% 120 68163 0.24% 121 94518 0.33% 122 163993 0.58% 123 449435 1.58% 124 1759760 6.19% 125 25170600 88.50% 28442706 reads passed initial QC criterion=sequence-density sequence-density=4.48 sequence-density-rank=1 fanout-score=46.39 fanout-score-rank=1 prefix-density=6.10 prefix-fanout=34.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=4.48 sequence-density-rank=1 fanout-score=46.39 fanout-score-rank=1 prefix-density=6.10 prefix-fanout=34.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208055 - Input file: STDIN trimmed: SRR3208055-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:59:28 2025 >> started Wed Feb 12 04:59:51 2025 >> done (23.654s) 17065624 reads processed; of these: 281 ( 0.00%) short reads filtered out after trimming by size control 4561 ( 0.03%) empty reads filtered out after trimming by size control 17060782 (99.97%) reads available; of these: 2322956 (13.62%) trimmed reads available after processing 14737826 (86.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 635 0.00% 19 637 0.00% 20 679 0.00% 21 764 0.00% 22 877 0.01% 23 835 0.00% 24 991 0.01% 25 1119 0.01% 26 1089 0.01% 27 1057 0.01% 28 1070 0.01% 29 1174 0.01% 30 1633 0.01% 31 1639 0.01% 32 1103 0.01% 33 1063 0.01% 34 1002 0.01% 35 1044 0.01% 36 1050 0.01% 37 1096 0.01% 38 1119 0.01% 39 1088 0.01% 40 1119 0.01% 41 1150 0.01% 42 1189 0.01% 43 1140 0.01% 44 1226 0.01% 45 1251 0.01% 46 1321 0.01% 47 1301 0.01% 48 1376 0.01% 49 1357 0.01% 50 1386 0.01% 51 1364 0.01% 52 1416 0.01% 53 1465 0.01% 54 1433 0.01% 55 1495 0.01% 56 1519 0.01% 57 1693 0.01% 58 1687 0.01% 59 1826 0.01% 60 1846 0.01% 61 1865 0.01% 62 1932 0.01% 63 1969 0.01% 64 2047 0.01% 65 1946 0.01% 66 2143 0.01% 67 2103 0.01% 68 2166 0.01% 69 2368 0.01% 70 2469 0.01% 71 2568 0.02% 72 2674 0.02% 73 2740 0.02% 74 2772 0.02% 75 2998 0.02% 76 3173 0.02% 77 3456 0.02% 78 3602 0.02% 79 3965 0.02% 80 4482 0.03% 81 4808 0.03% 82 5287 0.03% 83 5890 0.03% 84 6039 0.04% 85 6643 0.04% 86 7101 0.04% 87 7935 0.05% 88 8766 0.05% 89 9816 0.06% 90 11201 0.07% 91 12363 0.07% 92 14431 0.08% 93 16086 0.09% 94 18259 0.11% 95 19832 0.12% 96 21533 0.13% 97 23611 0.14% 98 25860 0.15% 99 28764 0.17% 100 33031 0.19% 101 37179 0.22% 102 41958 0.25% 103 46838 0.27% 104 51146 0.30% 105 54484 0.32% 106 56921 0.33% 107 60735 0.36% 108 63949 0.37% 109 69433 0.41% 110 75956 0.45% 111 83463 0.49% 112 91552 0.54% 113 100009 0.59% 114 107659 0.63% 115 113731 0.67% 116 117685 0.69% 117 122017 0.72% 118 128845 0.76% 119 143671 0.84% 120 175977 1.03% 121 255320 1.50% 122 530519 3.11% 123 239286 1.40% 124 946044 5.55% 125 12953387 75.92% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=55.06 fanout-score-rank=9 prefix-density=0.25 prefix-fanout=14.6 sequence=CACCACCACCATGGGCTCCCCAGCCACC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=332.32 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=29.8 sequence=TTCTTCTTCTTT Started job on | Feb 12 05:00:24 Started mapping on | Feb 12 05:00:24 Finished on | Feb 12 05:01:05 Mapping speed, Million of reads per hour | 2496.98 Number of input reads | 28437864 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 26722167 Uniquely mapped reads % | 93.97% Average mapped length | 122.44 Number of splices: Total | 9943060 Number of splices: Annotated (sjdb) | 9750336 Number of splices: GT/AG | 9789476 Number of splices: GC/AG | 125165 Number of splices: AT/AC | 10364 Number of splices: Non-canonical | 18055 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 576068 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 405776 % of reads mapped to too many loci | 1.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1139629 1139629 1139629 N_multimapping 576068 576068 576068 N_noFeature 1137894 13830331 13843737 N_ambiguous 281972 47597 48898 UnstrandedReadsAssigned:25302301 PositiveStrandReadsAssigned:12844239 NegativeStrandReadsAssigned:12829532 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208055 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208055-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,437,864 reads, 26,138,834 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,240 rounds 52401 SRR3208055.ke.tsv 34699 SRR3208055.se.tsv 87100 total ==> SRR3208055.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 994 27.813 Potri.005G024800.1.v4.1 1035 936 261 14.9728 Potri.004G059700.1.v4.1 961 862 52 3.23917 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 443.698 8.37713 Potri.016G087400.1.v4.1 270 171 1229 385.916 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 115 3.68875 Potri.012G127500.1.v4.1 977 878 6264 383.084 ==> SRR3208055.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2419 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 510 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 49 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3208055 completed mapping pipeline successfully