Starting /dee2/code/volunteer_pipeline.sh SRR3208056 current disk space = 3049048100864 free memory = 1578442652 SRR3208056 SRAfilesize 20587730ddf6b60f28f1084f37ab25de SRR3208056.sra SRR3208056.sra file validated SRR3208056 is single end SRR3208056 is conventional basespace SRR3208056 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208056_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.31475 33.0 33.0 33.0 33.0 33.0 2 32.08875 33.0 33.0 33.0 33.0 33.0 3 32.21025 33.0 33.0 33.0 33.0 33.0 4 32.28775 33.0 33.0 33.0 33.0 33.0 5 32.3805 33.0 33.0 33.0 33.0 33.0 6 36.14625 37.0 37.0 37.0 37.0 37.0 7 36.227 37.0 37.0 37.0 37.0 37.0 8 36.27075 37.0 37.0 37.0 37.0 37.0 9 36.231 37.0 37.0 37.0 37.0 37.0 10-11 36.270125 37.0 37.0 37.0 37.0 37.0 12-13 36.269375 37.0 37.0 37.0 37.0 37.0 14-15 36.23175 37.0 37.0 37.0 37.0 37.0 16-17 36.27175 37.0 37.0 37.0 37.0 37.0 18-19 36.238375000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.259125 37.0 37.0 37.0 37.0 37.0 22-23 36.265625 37.0 37.0 37.0 37.0 37.0 24-25 36.22 37.0 37.0 37.0 37.0 37.0 26-27 36.126374999999996 37.0 37.0 37.0 37.0 37.0 28-29 36.25625 37.0 37.0 37.0 37.0 37.0 30-31 36.214875 37.0 37.0 37.0 37.0 37.0 32-33 36.254374999999996 37.0 37.0 37.0 37.0 37.0 34-35 36.20125 37.0 37.0 37.0 37.0 37.0 36-37 36.244625 37.0 37.0 37.0 37.0 37.0 38-39 36.237 37.0 37.0 37.0 37.0 37.0 40-41 36.250625 37.0 37.0 37.0 37.0 37.0 42-43 36.260125 37.0 37.0 37.0 37.0 37.0 44-45 36.248374999999996 37.0 37.0 37.0 37.0 37.0 46-47 36.262874999999994 37.0 37.0 37.0 37.0 37.0 48-49 36.23175 37.0 37.0 37.0 37.0 37.0 50-51 36.226124999999996 37.0 37.0 37.0 37.0 37.0 52-53 36.191625 37.0 37.0 37.0 37.0 37.0 54-55 36.180499999999995 37.0 37.0 37.0 37.0 37.0 56-57 36.210499999999996 37.0 37.0 37.0 37.0 37.0 58-59 36.280625 37.0 37.0 37.0 37.0 37.0 60-61 36.1195 37.0 37.0 37.0 37.0 37.0 62-63 36.18825 37.0 37.0 37.0 37.0 37.0 64-65 36.146375 37.0 37.0 37.0 37.0 37.0 66-67 36.158500000000004 37.0 37.0 37.0 37.0 37.0 68-69 36.18425 37.0 37.0 37.0 37.0 37.0 70-71 36.184625 37.0 37.0 37.0 37.0 37.0 72-73 36.119749999999996 37.0 37.0 37.0 37.0 37.0 74-75 36.08175 37.0 37.0 37.0 37.0 37.0 76-77 36.05375 37.0 37.0 37.0 37.0 37.0 78-79 36.043499999999995 37.0 37.0 37.0 37.0 37.0 80-81 36.031875 37.0 37.0 37.0 37.0 37.0 82-83 35.982749999999996 37.0 37.0 37.0 37.0 37.0 84-85 36.010125 37.0 37.0 37.0 37.0 37.0 86-87 35.98975 37.0 37.0 37.0 37.0 37.0 88-89 35.957750000000004 37.0 37.0 37.0 37.0 37.0 90-91 35.940375 37.0 37.0 37.0 37.0 37.0 92-93 35.973625 37.0 37.0 37.0 37.0 37.0 94-95 35.895125 37.0 37.0 37.0 37.0 37.0 96-97 35.839625 37.0 37.0 37.0 37.0 37.0 98-99 35.83225 37.0 37.0 37.0 37.0 37.0 100-101 35.83925 37.0 37.0 37.0 37.0 37.0 102-103 35.797 37.0 37.0 37.0 37.0 37.0 104-105 35.70675 37.0 37.0 37.0 37.0 37.0 106-107 35.795625 37.0 37.0 37.0 37.0 37.0 108-109 35.710125 37.0 37.0 37.0 37.0 37.0 110-111 35.744375 37.0 37.0 37.0 37.0 37.0 112-113 35.666875000000005 37.0 37.0 37.0 37.0 37.0 114-115 35.7255 37.0 37.0 37.0 37.0 37.0 116-117 35.641875 37.0 37.0 37.0 37.0 37.0 118-119 35.638125 37.0 37.0 37.0 37.0 37.0 120-121 35.50325 37.0 37.0 37.0 37.0 37.0 122-123 35.512375000000006 37.0 37.0 37.0 37.0 37.0 124-125 33.951375 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 2.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 3.0 19 4.0 20 0.0 21 5.0 22 9.0 23 2.0 24 4.0 25 2.0 26 6.0 27 8.0 28 15.0 29 26.0 30 36.0 31 40.0 32 56.0 33 69.0 34 121.0 35 230.0 36 3327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.323339364176793 14.758335487205995 12.794003618506075 51.12432153011114 2 18.25 20.674999999999997 41.475 19.6 3 20.25 25.3 28.599999999999998 25.85 4 22.5 32.074999999999996 21.05 24.375 5 25.35 33.725 22.875 18.05 6 19.825 36.1 24.5 19.575 7 16.900000000000002 20.25 42.05 20.8 8 18.4 23.925 30.349999999999998 27.325 9 20.525 22.675 31.85 24.95 10-11 21.95 33.9125 22.5625 21.575 12-13 20.4625 26.2125 30.95 22.375 14-15 21.15 27.287499999999998 28.962500000000002 22.6 16-17 21.2875 28.125 28.3375 22.25 18-19 21.8 28.5625 27.55 22.0875 20-21 22.112499999999997 27.3375 28.225 22.325 22-23 21.6125 28.199999999999996 28.025 22.162499999999998 24-25 21.712500000000002 28.6625 27.0875 22.537499999999998 26-27 21.275 28.787499999999998 27.212500000000002 22.725 28-29 22.3125 28.925 26.775 21.987499999999997 30-31 21.135567783891947 28.976988494247124 27.838919459729865 22.048524262131068 32-33 20.810405202601302 28.064032016008007 28.36418209104552 22.761380690345174 34-35 21.395523321245467 28.173064899337252 27.485306990121295 22.946104789295983 36-37 21.380345086271568 28.569642410602654 27.481870467616904 22.568142035508878 38-39 20.8 28.9875 27.6875 22.525000000000002 40-41 22.2125 27.6625 28.012500000000003 22.112499999999997 42-43 21.925 29.312500000000004 27.1125 21.65 44-45 21.4375 28.3875 28.1375 22.037499999999998 46-47 21.637500000000003 28.375 27.375 22.6125 48-49 22.1 28.6125 27.025 22.2625 50-51 22.0 29.4 27.1125 21.4875 52-53 22.0125 28.325 27.2625 22.400000000000002 54-55 21.2375 28.512500000000003 27.725 22.525000000000002 56-57 22.05 28.825 26.525 22.6 58-59 21.587500000000002 29.8875 26.6 21.925 60-61 21.2625 27.900000000000002 27.975 22.8625 62-63 21.1125 29.2 27.462500000000002 22.225 64-65 21.175 27.9375 28.025 22.8625 66-67 21.1875 28.262500000000003 27.8375 22.7125 68-69 21.3125 28.5875 28.4125 21.6875 70-71 21.3 28.95 27.800000000000004 21.95 72-73 21.675 28.299999999999997 27.925 22.1 74-75 21.762500000000003 27.575 28.5875 22.075 76-77 21.0125 28.8875 28.525 21.575 78-79 21.6625 28.4 27.3375 22.6 80-81 20.424999999999997 29.212500000000002 28.299999999999997 22.0625 82-83 21.525 28.8875 27.450000000000003 22.1375 84-85 21.8125 29.15 27.200000000000003 21.837500000000002 86-87 22.1 27.175 28.8375 21.8875 88-89 22.3375 28.175 27.525 21.9625 90-91 21.8625 27.9375 27.3375 22.8625 92-93 21.925 28.712500000000002 27.700000000000003 21.6625 94-95 21.6125 28.849999999999998 27.6625 21.875 96-97 22.35 27.700000000000003 28.349999999999998 21.6 98-99 22.525000000000002 27.787499999999998 27.987499999999997 21.7 100-101 22.0 27.925 28.787499999999998 21.2875 102-103 21.8625 27.075 28.1 22.9625 104-105 22.05 28.8875 27.175 21.8875 106-107 21.9625 28.262500000000003 27.85 21.925 108-109 22.675 28.1625 27.6625 21.5 110-111 22.75 28.6125 27.200000000000003 21.4375 112-113 22.875 28.3375 26.8125 21.975 114-115 22.35 28.175 27.525 21.95 116-117 22.8625 28.3375 27.075 21.725 118-119 23.125 28.762500000000003 26.3625 21.75 120-121 22.8375 29.575000000000003 26.237500000000004 21.349999999999998 122-123 24.0125 28.9875 25.937500000000004 21.0625 124-125 23.2875 29.45 25.575 21.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 2.0 23 3.5 24 2.0 25 2.0 26 4.0 27 7.0 28 13.5 29 18.0 30 22.0 31 28.5 32 36.0 33 54.5 34 62.0 35 65.0 36 88.5 37 108.0 38 127.5 39 161.0 40 203.0 41 225.5 42 221.5 43 244.5 44 273.5 45 281.0 46 268.0 47 250.5 48 232.0 49 198.0 50 170.5 51 148.0 52 115.5 53 81.5 54 65.5 55 53.5 56 37.0 57 27.0 58 20.0 59 11.0 60 10.5 61 11.5 62 9.5 63 6.5 64 5.0 65 3.0 66 1.5 67 2.5 68 2.5 69 3.0 70 2.5 71 0.5 72 1.5 73 2.5 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2750000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.05 32-33 0.05 34-35 0.0375 36-37 0.025 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82442939553549 99.5 2 0.1254075746175069 0.25 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025081514923501375 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 19 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.0875 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.2875 0.0 0.0 0.0 0.0 106-107 2.8375 0.0 0.0 0.0 0.0 108-109 3.2875 0.0 0.0 0.0 0.0 110-111 3.9000000000000004 0.0 0.0 0.0 0.0 112-113 4.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976395 spots for SRR3208056.sra Written 976395 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra Read 976383 spots for SRR3208056.sra Written 976383 spots for SRR3208056.sra SRR ids: ['SRR3208056.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oy150jci SRR3208056.sra spots: 19527672 blocks: [[1, 976383], [976384, 1952766], [1952767, 2929149], [2929150, 3905532], [3905533, 4881915], [4881916, 5858298], [5858299, 6834681], [6834682, 7811064], [7811065, 8787447], [8787448, 9763830], [9763831, 10740213], [10740214, 11716596], [11716597, 12692979], [12692980, 13669362], [13669363, 14645745], [14645746, 15622128], [15622129, 16598511], [16598512, 17574894], [17574895, 18551277], [18551278, 19527672]] SRR3208056 file size 6253578 SRR3208056 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208056 SRR3208056_1.fastq Input file: SRR3208056_1.fastq trimmed: SRR3208056-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 05:07:18 2025 >> started Wed Feb 12 05:07:28 2025 >> done (9.681s) 19527672 reads processed; of these: 16141 ( 0.08%) short reads filtered out after trimming by size control 95262 ( 0.49%) empty reads filtered out after trimming by size control 19416269 (99.43%) reads available; of these: 2121342 (10.93%) trimmed reads available after processing 17294927 (89.07%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 632 0.00% 19 763 0.00% 20 1561 0.01% 21 758 0.00% 22 754 0.00% 23 876 0.00% 24 1040 0.01% 25 1116 0.01% 26 1033 0.01% 27 1032 0.01% 28 981 0.01% 29 1123 0.01% 30 1378 0.01% 31 1335 0.01% 32 1039 0.01% 33 1045 0.01% 34 1016 0.01% 35 1009 0.01% 36 995 0.01% 37 1051 0.01% 38 996 0.01% 39 1036 0.01% 40 1031 0.01% 41 1039 0.01% 42 1091 0.01% 43 1136 0.01% 44 1138 0.01% 45 1110 0.01% 46 1148 0.01% 47 1118 0.01% 48 1174 0.01% 49 1199 0.01% 50 1204 0.01% 51 1289 0.01% 52 1362 0.01% 53 1268 0.01% 54 1290 0.01% 55 1341 0.01% 56 1395 0.01% 57 1434 0.01% 58 1548 0.01% 59 1575 0.01% 60 1638 0.01% 61 1693 0.01% 62 1645 0.01% 63 1713 0.01% 64 1812 0.01% 65 2014 0.01% 66 1905 0.01% 67 1857 0.01% 68 2031 0.01% 69 2118 0.01% 70 2135 0.01% 71 2402 0.01% 72 2516 0.01% 73 2537 0.01% 74 2682 0.01% 75 2910 0.01% 76 3116 0.02% 77 3139 0.02% 78 3380 0.02% 79 3778 0.02% 80 4272 0.02% 81 4665 0.02% 82 5081 0.03% 83 5916 0.03% 84 6207 0.03% 85 6763 0.03% 86 7215 0.04% 87 7973 0.04% 88 8976 0.05% 89 10132 0.05% 90 11851 0.06% 91 13439 0.07% 92 15398 0.08% 93 17122 0.09% 94 2872 0.01% 95 3182 0.02% 96 3274 0.02% 97 3470 0.02% 98 3480 0.02% 99 3578 0.02% 100 3923 0.02% 101 3912 0.02% 102 4333 0.02% 103 4459 0.02% 104 4637 0.02% 105 5038 0.03% 106 5311 0.03% 107 5800 0.03% 108 6488 0.03% 109 7061 0.04% 110 7712 0.04% 111 8403 0.04% 112 9438 0.05% 113 10823 0.06% 114 12254 0.06% 115 14553 0.07% 116 16744 0.09% 117 20116 0.10% 118 25393 0.13% 119 33684 0.17% 120 43500 0.22% 121 61122 0.31% 122 106163 0.55% 123 295961 1.52% 124 1165168 6.00% 125 17294927 89.07% 19416269 reads passed initial QC criterion=sequence-density sequence-density=4.41 sequence-density-rank=1 fanout-score=48.32 fanout-score-rank=1 prefix-density=5.99 prefix-fanout=35.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=4.41 sequence-density-rank=1 fanout-score=48.32 fanout-score-rank=1 prefix-density=5.99 prefix-fanout=35.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208056 - Input file: STDIN trimmed: SRR3208056-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 05:08:20 2025 >> started Wed Feb 12 05:08:32 2025 >> done (12.023s) 11649762 reads processed; of these: 170 ( 0.00%) short reads filtered out after trimming by size control 693 ( 0.01%) empty reads filtered out after trimming by size control 11648899 (99.99%) reads available; of these: 1562592 (13.41%) trimmed reads available after processing 10086307 (86.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 382 0.00% 19 495 0.00% 20 1460 0.01% 21 461 0.00% 22 459 0.00% 23 536 0.00% 24 615 0.01% 25 669 0.01% 26 648 0.01% 27 623 0.01% 28 580 0.00% 29 668 0.01% 30 839 0.01% 31 787 0.01% 32 666 0.01% 33 614 0.01% 34 595 0.01% 35 608 0.01% 36 617 0.01% 37 610 0.01% 38 611 0.01% 39 659 0.01% 40 608 0.01% 41 647 0.01% 42 671 0.01% 43 675 0.01% 44 662 0.01% 45 671 0.01% 46 701 0.01% 47 670 0.01% 48 738 0.01% 49 713 0.01% 50 749 0.01% 51 766 0.01% 52 838 0.01% 53 784 0.01% 54 792 0.01% 55 796 0.01% 56 843 0.01% 57 877 0.01% 58 962 0.01% 59 963 0.01% 60 986 0.01% 61 1047 0.01% 62 1004 0.01% 63 1048 0.01% 64 1045 0.01% 65 1030 0.01% 66 1093 0.01% 67 1139 0.01% 68 1234 0.01% 69 1264 0.01% 70 1276 0.01% 71 1411 0.01% 72 1557 0.01% 73 1510 0.01% 74 1589 0.01% 75 1648 0.01% 76 1685 0.01% 77 1811 0.02% 78 1974 0.02% 79 2299 0.02% 80 2567 0.02% 81 2793 0.02% 82 3085 0.03% 83 3468 0.03% 84 3748 0.03% 85 4011 0.03% 86 4325 0.04% 87 4803 0.04% 88 5433 0.05% 89 6131 0.05% 90 7076 0.06% 91 7873 0.07% 92 9153 0.08% 93 10259 0.09% 94 11674 0.10% 95 12880 0.11% 96 13806 0.12% 97 15293 0.13% 98 16860 0.14% 99 18751 0.16% 100 21656 0.19% 101 24392 0.21% 102 27681 0.24% 103 31100 0.27% 104 33543 0.29% 105 36519 0.31% 106 37921 0.33% 107 40253 0.35% 108 43277 0.37% 109 46771 0.40% 110 50921 0.44% 111 55784 0.48% 112 61300 0.53% 113 66456 0.57% 114 71637 0.61% 115 75303 0.65% 116 78805 0.68% 117 81134 0.70% 118 86279 0.74% 119 95016 0.82% 120 117493 1.01% 121 171738 1.47% 122 359839 3.09% 123 158505 1.36% 124 621760 5.34% 125 8932849 76.68% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=25.44 fanout-score-rank=9 prefix-density=0.15 prefix-fanout=10.1 sequence=CTGCAGCTGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=245.98 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=27.1 sequence=AAGAAGAAGAAA Started job on | Feb 12 05:08:59 Started mapping on | Feb 12 05:08:59 Finished on | Feb 12 05:09:32 Mapping speed, Million of reads per hour | 2118.04 Number of input reads | 19415406 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 18226412 Uniquely mapped reads % | 93.88% Average mapped length | 122.55 Number of splices: Total | 6802233 Number of splices: Annotated (sjdb) | 6673852 Number of splices: GT/AG | 6699325 Number of splices: GC/AG | 83997 Number of splices: AT/AC | 7051 Number of splices: Non-canonical | 11860 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384378 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 359518 % of reads mapped to too many loci | 1.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.28% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 804616 804616 804616 N_multimapping 384378 384378 384378 N_noFeature 769686 9441179 9426351 N_ambiguous 193131 32117 32745 UnstrandedReadsAssigned:17263595 PositiveStrandReadsAssigned:8753116 NegativeStrandReadsAssigned:8767316 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208056 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208056-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,415,406 reads, 17,909,127 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR3208056.ke.tsv 34699 SRR3208056.se.tsv 87100 total ==> SRR3208056.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 709 29.2498 Potri.005G024800.1.v4.1 1035 936 121 10.2344 Potri.004G059700.1.v4.1 961 862 40 3.67371 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 262.26 7.30053 Potri.016G087400.1.v4.1 270 171 711 329.174 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 76.5448 3.62004 Potri.012G127500.1.v4.1 977 878 3289 296.566 ==> SRR3208056.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1926 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 41 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3208056 completed mapping pipeline successfully