Starting /dee2/code/volunteer_pipeline.sh SRR3208057 current disk space = 3049012322304 free memory = 1577856280 SRR3208057 SRAfilesize 5b650223204fdcc5add923f7caadc859 SRR3208057.sra SRR3208057.sra file validated SRR3208057 is single end SRR3208057 is conventional basespace SRR3208057 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208057_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4165 33.0 33.0 33.0 33.0 33.0 2 32.05775 33.0 33.0 33.0 33.0 33.0 3 32.02325 33.0 33.0 33.0 33.0 33.0 4 32.24475 33.0 33.0 33.0 33.0 33.0 5 32.348 33.0 33.0 33.0 33.0 33.0 6 36.04 37.0 37.0 37.0 37.0 37.0 7 36.183 37.0 37.0 37.0 37.0 37.0 8 36.276 37.0 37.0 37.0 37.0 37.0 9 36.228 37.0 37.0 37.0 37.0 37.0 10-11 36.308875 37.0 37.0 37.0 37.0 37.0 12-13 36.303124999999994 37.0 37.0 37.0 37.0 37.0 14-15 36.26525 37.0 37.0 37.0 37.0 37.0 16-17 36.289 37.0 37.0 37.0 37.0 37.0 18-19 36.2945 37.0 37.0 37.0 37.0 37.0 20-21 36.24125 37.0 37.0 37.0 37.0 37.0 22-23 36.27875 37.0 37.0 37.0 37.0 37.0 24-25 36.16975 37.0 37.0 37.0 37.0 37.0 26-27 35.9805 37.0 37.0 37.0 37.0 37.0 28-29 36.199125 37.0 37.0 37.0 37.0 37.0 30-31 36.169875000000005 37.0 37.0 37.0 37.0 37.0 32-33 36.2755 37.0 37.0 37.0 37.0 37.0 34-35 36.252375 37.0 37.0 37.0 37.0 37.0 36-37 36.19725 37.0 37.0 37.0 37.0 37.0 38-39 36.238875 37.0 37.0 37.0 37.0 37.0 40-41 36.204125 37.0 37.0 37.0 37.0 37.0 42-43 36.2685 37.0 37.0 37.0 37.0 37.0 44-45 36.111374999999995 37.0 37.0 37.0 37.0 37.0 46-47 36.197625 37.0 37.0 37.0 37.0 37.0 48-49 36.208625 37.0 37.0 37.0 37.0 37.0 50-51 36.228 37.0 37.0 37.0 37.0 37.0 52-53 36.122625 37.0 37.0 37.0 37.0 37.0 54-55 36.226125 37.0 37.0 37.0 37.0 37.0 56-57 36.223 37.0 37.0 37.0 37.0 37.0 58-59 36.159875 37.0 37.0 37.0 37.0 37.0 60-61 36.156875 37.0 37.0 37.0 37.0 37.0 62-63 36.15837500000001 37.0 37.0 37.0 37.0 37.0 64-65 36.16374999999999 37.0 37.0 37.0 37.0 37.0 66-67 36.158875 37.0 37.0 37.0 37.0 37.0 68-69 36.24725 37.0 37.0 37.0 37.0 37.0 70-71 36.181375 37.0 37.0 37.0 37.0 37.0 72-73 36.08925 37.0 37.0 37.0 37.0 37.0 74-75 36.110749999999996 37.0 37.0 37.0 37.0 37.0 76-77 36.06175 37.0 37.0 37.0 37.0 37.0 78-79 36.03637500000001 37.0 37.0 37.0 37.0 37.0 80-81 35.998875 37.0 37.0 37.0 37.0 37.0 82-83 35.968875 37.0 37.0 37.0 37.0 37.0 84-85 36.004625000000004 37.0 37.0 37.0 37.0 37.0 86-87 35.97625 37.0 37.0 37.0 37.0 37.0 88-89 35.970749999999995 37.0 37.0 37.0 37.0 37.0 90-91 35.967625 37.0 37.0 37.0 37.0 37.0 92-93 35.959125 37.0 37.0 37.0 37.0 37.0 94-95 35.900625 37.0 37.0 37.0 37.0 37.0 96-97 35.885999999999996 37.0 37.0 37.0 37.0 37.0 98-99 35.825 37.0 37.0 37.0 37.0 37.0 100-101 35.8645 37.0 37.0 37.0 37.0 37.0 102-103 35.823125 37.0 37.0 37.0 37.0 37.0 104-105 35.838625 37.0 37.0 37.0 37.0 37.0 106-107 35.880375 37.0 37.0 37.0 37.0 37.0 108-109 35.74025 37.0 37.0 37.0 37.0 37.0 110-111 35.789249999999996 37.0 37.0 37.0 37.0 37.0 112-113 35.772000000000006 37.0 37.0 37.0 37.0 37.0 114-115 35.705375000000004 37.0 37.0 37.0 37.0 37.0 116-117 35.640625 37.0 37.0 37.0 37.0 37.0 118-119 35.712375 37.0 37.0 37.0 37.0 37.0 120-121 35.56625 37.0 37.0 37.0 37.0 37.0 122-123 35.42825 37.0 37.0 37.0 37.0 37.0 124-125 34.10425 37.0 37.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 1.0 4 2.0 5 0.0 6 0.0 7 0.0 8 2.0 9 2.0 10 1.0 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 1.0 20 1.0 21 1.0 22 9.0 23 4.0 24 2.0 25 6.0 26 13.0 27 10.0 28 18.0 29 27.0 30 32.0 31 35.0 32 71.0 33 70.0 34 123.0 35 277.0 36 3265.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.236470889971788 15.209027955886127 12.746858168761221 49.807642985380866 2 18.625 20.849999999999998 39.475 21.05 3 20.724999999999998 24.5 29.125 25.650000000000002 4 22.400000000000002 31.674999999999997 20.349999999999998 25.575 5 25.2 34.425 23.3 17.075000000000003 6 19.8 36.075 24.099999999999998 20.025000000000002 7 16.625 18.875 42.5 22.0 8 17.875 24.075 31.5 26.55 9 19.675 22.55 33.25 24.525 10-11 22.3 33.5 23.6125 20.5875 12-13 19.6 28.0625 28.6875 23.65 14-15 21.1125 27.650000000000002 28.249999999999996 22.9875 16-17 21.925 27.825 27.6125 22.6375 18-19 22.15 28.175 28.15 21.525 20-21 22.375 28.0875 26.575 22.9625 22-23 21.5 29.012500000000003 27.212500000000002 22.275 24-25 20.925 29.212500000000002 28.175 21.6875 26-27 21.3625 29.575000000000003 27.150000000000002 21.912499999999998 28-29 21.65 28.249999999999996 27.8875 22.2125 30-31 21.275 28.975 28.349999999999998 21.4 32-33 21.05 28.799999999999997 27.5625 22.5875 34-35 21.3875 29.462500000000002 27.3125 21.837500000000002 36-37 21.837500000000002 28.475 27.5875 22.1 38-39 21.912499999999998 28.712500000000002 27.075 22.3 40-41 21.0375 29.212500000000002 27.1125 22.6375 42-43 22.075 28.050000000000004 27.462500000000002 22.412499999999998 44-45 21.0 27.8125 28.549999999999997 22.6375 46-47 21.675 28.3625 28.487499999999997 21.475 48-49 22.075 28.5625 27.525 21.837500000000002 50-51 21.775 28.475 28.462500000000002 21.2875 52-53 22.05 28.712500000000002 26.825 22.412499999999998 54-55 22.5 28.4125 26.875 22.2125 56-57 21.525 29.062500000000004 27.1 22.3125 58-59 22.45 28.0625 27.3375 22.15 60-61 22.475 27.650000000000002 27.8125 22.0625 62-63 22.287499999999998 27.925 27.725 22.0625 64-65 22.825 28.199999999999996 27.212500000000002 21.762500000000003 66-67 21.45 28.212500000000002 28.787499999999998 21.55 68-69 22.0875 27.962500000000002 27.224999999999998 22.725 70-71 22.0125 29.262500000000003 26.875 21.85 72-73 22.225 28.675 27.5875 21.512500000000003 74-75 20.7125 28.9 27.987499999999997 22.400000000000002 76-77 22.5875 28.1125 28.449999999999996 20.849999999999998 78-79 22.152769096137018 29.016127015876986 27.50343792974122 21.327665958244783 80-81 21.94298574643661 28.432108027006752 28.069517379344838 21.555388847211805 82-83 21.65270658832354 28.9536192024003 27.565945743217902 21.827728466058257 84-85 21.4875 27.987499999999997 28.1875 22.3375 86-87 21.5375 28.199999999999996 27.6 22.662499999999998 88-89 21.65 29.325000000000003 26.937499999999996 22.0875 90-91 22.0 27.6375 27.750000000000004 22.6125 92-93 21.3 28.5875 28.125 21.987499999999997 94-95 21.7375 28.812500000000004 27.425 22.025 96-97 22.475 28.15 27.1 22.275 98-99 21.9 28.9 27.6625 21.5375 100-101 22.35 28.9 27.325 21.425 102-103 22.5125 27.775 28.325 21.3875 104-105 22.15 28.3125 27.962500000000002 21.575 106-107 23.0125 28.249999999999996 27.375 21.3625 108-109 21.55 29.15 26.924999999999997 22.375 110-111 23.150000000000002 28.65 27.0875 21.1125 112-113 22.725 28.525 27.125 21.625 114-115 23.2125 28.675 26.775 21.337500000000002 116-117 22.6 29.15 27.1 21.15 118-119 22.9625 28.9375 26.625 21.475 120-121 23.799999999999997 29.4125 25.35 21.4375 122-123 23.2375 29.425 25.55 21.7875 124-125 23.2375 29.9875 25.474999999999998 21.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 2.0 24 4.5 25 5.5 26 6.5 27 11.0 28 11.0 29 14.5 30 21.5 31 29.5 32 42.0 33 52.5 34 62.5 35 75.0 36 91.5 37 104.5 38 133.5 39 166.5 40 190.0 41 217.5 42 238.0 43 264.5 44 277.0 45 265.0 46 254.0 47 236.5 48 212.0 49 189.0 50 161.0 51 134.0 52 116.5 53 94.0 54 62.5 55 45.5 56 38.5 57 32.0 58 26.0 59 19.5 60 16.5 61 13.0 62 8.5 63 6.5 64 4.5 65 4.0 66 4.0 67 6.0 68 8.5 69 4.5 70 1.0 71 0.5 72 2.0 73 2.5 74 2.5 75 1.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.025 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79934788061199 99.47500000000001 2 0.17557060446450964 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025081514923501375 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.5125 0.0 0.0 0.0 0.0 102-103 1.925 0.0 0.0 0.0 0.0 104-105 2.3 0.0 0.0 0.0 0.0 106-107 2.825 0.0 0.0 0.0 0.0 108-109 3.3875 0.0 0.0 0.0 0.0 110-111 4.0875 0.0 0.0 0.0 0.0 112-113 5.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956707 spots for SRR3208057.sra Written 956707 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra Read 956696 spots for SRR3208057.sra Written 956696 spots for SRR3208057.sra SRR ids: ['SRR3208057.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ae4ldnxx SRR3208057.sra spots: 19133931 blocks: [[1, 956696], [956697, 1913392], [1913393, 2870088], [2870089, 3826784], [3826785, 4783480], [4783481, 5740176], [5740177, 6696872], [6696873, 7653568], [7653569, 8610264], [8610265, 9566960], [9566961, 10523656], [10523657, 11480352], [11480353, 12437048], [12437049, 13393744], [13393745, 14350440], [14350441, 15307136], [15307137, 16263832], [16263833, 17220528], [17220529, 18177224], [18177225, 19133931]] SRR3208057 file size 6127338 SRR3208057 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208057 SRR3208057_1.fastq Input file: SRR3208057_1.fastq trimmed: SRR3208057-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 05:10:45 2025 >> started Wed Feb 12 05:10:55 2025 >> done (10.371s) 19133931 reads processed; of these: 14007 ( 0.07%) short reads filtered out after trimming by size control 89393 ( 0.47%) empty reads filtered out after trimming by size control 19030531 (99.46%) reads available; of these: 2109430 (11.08%) trimmed reads available after processing 16921101 (88.92%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 524 0.00% 19 572 0.00% 20 600 0.00% 21 656 0.00% 22 714 0.00% 23 705 0.00% 24 882 0.00% 25 1062 0.01% 26 1031 0.01% 27 977 0.01% 28 970 0.01% 29 982 0.01% 30 1319 0.01% 31 1134 0.01% 32 1039 0.01% 33 950 0.00% 34 921 0.00% 35 979 0.01% 36 908 0.00% 37 984 0.01% 38 1029 0.01% 39 927 0.00% 40 1013 0.01% 41 1003 0.01% 42 1067 0.01% 43 1071 0.01% 44 1061 0.01% 45 1162 0.01% 46 1103 0.01% 47 1105 0.01% 48 1108 0.01% 49 1218 0.01% 50 1222 0.01% 51 1230 0.01% 52 1253 0.01% 53 1323 0.01% 54 1362 0.01% 55 1354 0.01% 56 1407 0.01% 57 1509 0.01% 58 1512 0.01% 59 1618 0.01% 60 1719 0.01% 61 1723 0.01% 62 1834 0.01% 63 1822 0.01% 64 1811 0.01% 65 1878 0.01% 66 1927 0.01% 67 1996 0.01% 68 2149 0.01% 69 2272 0.01% 70 2371 0.01% 71 2554 0.01% 72 2706 0.01% 73 2857 0.02% 74 2955 0.02% 75 3562 0.02% 76 4020 0.02% 77 3647 0.02% 78 3835 0.02% 79 4271 0.02% 80 4789 0.03% 81 5334 0.03% 82 5927 0.03% 83 6625 0.03% 84 7097 0.04% 85 7777 0.04% 86 8450 0.04% 87 9149 0.05% 88 10445 0.05% 89 11489 0.06% 90 13368 0.07% 91 15410 0.08% 92 17638 0.09% 93 19169 0.10% 94 2814 0.01% 95 2983 0.02% 96 3065 0.02% 97 3189 0.02% 98 3518 0.02% 99 3750 0.02% 100 4165 0.02% 101 4608 0.02% 102 4628 0.02% 103 5081 0.03% 104 4682 0.02% 105 5194 0.03% 106 5328 0.03% 107 5732 0.03% 108 6528 0.03% 109 7026 0.04% 110 7812 0.04% 111 8895 0.05% 112 9876 0.05% 113 11406 0.06% 114 13258 0.07% 115 15268 0.08% 116 18029 0.09% 117 21669 0.11% 118 27529 0.14% 119 35638 0.19% 120 48040 0.25% 121 67330 0.35% 122 109829 0.58% 123 239248 1.26% 124 1164170 6.12% 125 16921101 88.92% 19030531 reads passed initial QC criterion=sequence-density sequence-density=4.92 sequence-density-rank=1 fanout-score=47.50 fanout-score-rank=1 prefix-density=6.70 prefix-fanout=34.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=4.92 sequence-density-rank=1 fanout-score=47.50 fanout-score-rank=1 prefix-density=6.70 prefix-fanout=34.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATGCCGTCTTCTGCTTGAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATGCCGTCTTCTGCTTGAAA -o SRR3208057 - Input file: STDIN trimmed: SRR3208057-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 05:11:39 2025 >> started Wed Feb 12 05:11:51 2025 >> done (11.824s) 11418319 reads processed; of these: 95 ( 0.00%) short reads filtered out after trimming by size control 1138 ( 0.01%) empty reads filtered out after trimming by size control 11417086 (99.99%) reads available; of these: 1669743 (14.62%) trimmed reads available after processing 9747343 (85.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 332 0.00% 19 356 0.00% 20 372 0.00% 21 415 0.00% 22 439 0.00% 23 416 0.00% 24 527 0.00% 25 631 0.01% 26 618 0.01% 27 586 0.01% 28 578 0.01% 29 613 0.01% 30 785 0.01% 31 658 0.01% 32 620 0.01% 33 553 0.00% 34 539 0.00% 35 613 0.01% 36 554 0.00% 37 614 0.01% 38 645 0.01% 39 597 0.01% 40 627 0.01% 41 635 0.01% 42 670 0.01% 43 643 0.01% 44 640 0.01% 45 675 0.01% 46 720 0.01% 47 655 0.01% 48 688 0.01% 49 697 0.01% 50 726 0.01% 51 728 0.01% 52 741 0.01% 53 777 0.01% 54 850 0.01% 55 805 0.01% 56 860 0.01% 57 893 0.01% 58 911 0.01% 59 1003 0.01% 60 1027 0.01% 61 1031 0.01% 62 1071 0.01% 63 1099 0.01% 64 1083 0.01% 65 1098 0.01% 66 1135 0.01% 67 1200 0.01% 68 1332 0.01% 69 1366 0.01% 70 1406 0.01% 71 1556 0.01% 72 1584 0.01% 73 1678 0.01% 74 1713 0.02% 75 1930 0.02% 76 1982 0.02% 77 2029 0.02% 78 2240 0.02% 79 2559 0.02% 80 2862 0.03% 81 3153 0.03% 82 3566 0.03% 83 3941 0.03% 84 4343 0.04% 85 4756 0.04% 86 5094 0.04% 87 5521 0.05% 88 6265 0.05% 89 6986 0.06% 90 8015 0.07% 91 9147 0.08% 92 10561 0.09% 93 11928 0.10% 94 13196 0.12% 95 14469 0.13% 96 15557 0.14% 97 17189 0.15% 98 18775 0.16% 99 21075 0.18% 100 24106 0.21% 101 27578 0.24% 102 30931 0.27% 103 34324 0.30% 104 37497 0.33% 105 40169 0.35% 106 41508 0.36% 107 44236 0.39% 108 46765 0.41% 109 50027 0.44% 110 54707 0.48% 111 60472 0.53% 112 66445 0.58% 113 72435 0.63% 114 78287 0.69% 115 81998 0.72% 116 85551 0.75% 117 88416 0.77% 118 92930 0.81% 119 102934 0.90% 120 124776 1.09% 121 178033 1.56% 122 359705 3.15% 123 127174 1.11% 124 620848 5.44% 125 8601711 75.34% criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=43 prefix-density=0.07 prefix-fanout=2.0 sequence=CAGTTGGGCACC criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=209.98 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=25.5 sequence=AAGAAGAAGAAA Started job on | Feb 12 05:12:19 Started mapping on | Feb 12 05:12:19 Finished on | Feb 12 05:12:51 Mapping speed, Million of reads per hour | 2140.80 Number of input reads | 19029298 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 17436894 Uniquely mapped reads % | 91.63% Average mapped length | 122.34 Number of splices: Total | 6257437 Number of splices: Annotated (sjdb) | 6130568 Number of splices: GT/AG | 6159693 Number of splices: GC/AG | 78662 Number of splices: AT/AC | 6851 Number of splices: Non-canonical | 12231 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382446 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 650161 % of reads mapped to too many loci | 3.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.93% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1209958 1209958 1209958 N_multimapping 382446 382446 382446 N_noFeature 794319 9031914 9056090 N_ambiguous 210948 33819 34291 UnstrandedReadsAssigned:16431627 PositiveStrandReadsAssigned:8371161 NegativeStrandReadsAssigned:8346513 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208057 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208057-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,029,298 reads, 17,348,512 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR3208057.ke.tsv 34699 SRR3208057.se.tsv 87100 total ==> SRR3208057.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 656 27.5984 Potri.005G024800.1.v4.1 1035 936 84 7.24533 Potri.004G059700.1.v4.1 961 862 31 2.90342 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 221.039 6.27473 Potri.016G087400.1.v4.1 270 171 750 354.095 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 84 4.05115 Potri.012G127500.1.v4.1 977 878 3233 297.28 ==> SRR3208057.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1906 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 406 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 35 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 15 SRR3208057 completed mapping pipeline successfully