Starting /dee2/code/volunteer_pipeline.sh SRR3208058 current disk space = 3049060720640 free memory = 1498826492 SRR3208058 SRAfilesize f7dc871457360afe5431e7d747b7cbc8 SRR3208058.sra SRR3208058.sra file validated SRR3208058 is single end SRR3208058 is conventional basespace SRR3208058 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208058_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8435 33.0 33.0 33.0 33.0 33.0 2 32.259 33.0 33.0 33.0 33.0 33.0 3 32.25475 33.0 33.0 33.0 33.0 33.0 4 32.40975 33.0 33.0 33.0 33.0 33.0 5 32.401 33.0 33.0 33.0 33.0 33.0 6 36.08275 37.0 37.0 37.0 37.0 37.0 7 36.26825 37.0 37.0 37.0 37.0 37.0 8 36.23925 37.0 37.0 37.0 37.0 37.0 9 36.32325 37.0 37.0 37.0 37.0 37.0 10-11 36.302375 37.0 37.0 37.0 37.0 37.0 12-13 36.308125000000004 37.0 37.0 37.0 37.0 37.0 14-15 36.33025 37.0 37.0 37.0 37.0 37.0 16-17 36.3005 37.0 37.0 37.0 37.0 37.0 18-19 36.2785 37.0 37.0 37.0 37.0 37.0 20-21 36.319500000000005 37.0 37.0 37.0 37.0 37.0 22-23 36.283 37.0 37.0 37.0 37.0 37.0 24-25 36.29075 37.0 37.0 37.0 37.0 37.0 26-27 36.323125000000005 37.0 37.0 37.0 37.0 37.0 28-29 36.316625 37.0 37.0 37.0 37.0 37.0 30-31 36.294624999999996 37.0 37.0 37.0 37.0 37.0 32-33 36.268249999999995 37.0 37.0 37.0 37.0 37.0 34-35 36.289875 37.0 37.0 37.0 37.0 37.0 36-37 36.230125 37.0 37.0 37.0 37.0 37.0 38-39 36.252375 37.0 37.0 37.0 37.0 37.0 40-41 36.211 37.0 37.0 37.0 37.0 37.0 42-43 36.167249999999996 37.0 37.0 37.0 37.0 37.0 44-45 36.26875 37.0 37.0 37.0 37.0 37.0 46-47 36.2765 37.0 37.0 37.0 37.0 37.0 48-49 36.278375 37.0 37.0 37.0 37.0 37.0 50-51 36.270625 37.0 37.0 37.0 37.0 37.0 52-53 36.265625 37.0 37.0 37.0 37.0 37.0 54-55 36.2375 37.0 37.0 37.0 37.0 37.0 56-57 36.212875 37.0 37.0 37.0 37.0 37.0 58-59 36.175 37.0 37.0 37.0 37.0 37.0 60-61 36.260875 37.0 37.0 37.0 37.0 37.0 62-63 36.300875000000005 37.0 37.0 37.0 37.0 37.0 64-65 36.2695 37.0 37.0 37.0 37.0 37.0 66-67 36.2505 37.0 37.0 37.0 37.0 37.0 68-69 36.1845 37.0 37.0 37.0 37.0 37.0 70-71 36.180625 37.0 37.0 37.0 37.0 37.0 72-73 36.201 37.0 37.0 37.0 37.0 37.0 74-75 36.160624999999996 37.0 37.0 37.0 37.0 37.0 76-77 36.140125 37.0 37.0 37.0 37.0 37.0 78-79 36.157875000000004 37.0 37.0 37.0 37.0 37.0 80-81 36.068 37.0 37.0 37.0 37.0 37.0 82-83 36.048500000000004 37.0 37.0 37.0 37.0 37.0 84-85 36.036 37.0 37.0 37.0 37.0 37.0 86-87 36.11775 37.0 37.0 37.0 37.0 37.0 88-89 36.084875 37.0 37.0 37.0 37.0 37.0 90-91 36.100125 37.0 37.0 37.0 37.0 37.0 92-93 36.032624999999996 37.0 37.0 37.0 37.0 37.0 94-95 36.0965 37.0 37.0 37.0 37.0 37.0 96-97 35.980875 37.0 37.0 37.0 37.0 37.0 98-99 35.93375 37.0 37.0 37.0 37.0 37.0 100-101 35.944 37.0 37.0 37.0 37.0 37.0 102-103 35.92525 37.0 37.0 37.0 37.0 37.0 104-105 35.867625000000004 37.0 37.0 37.0 37.0 37.0 106-107 35.900875 37.0 37.0 37.0 37.0 37.0 108-109 35.89375 37.0 37.0 37.0 37.0 37.0 110-111 35.853875 37.0 37.0 37.0 37.0 37.0 112-113 35.805875 37.0 37.0 37.0 37.0 37.0 114-115 35.827875000000006 37.0 37.0 37.0 37.0 37.0 116-117 35.720375000000004 37.0 37.0 37.0 37.0 37.0 118-119 35.8055 37.0 37.0 37.0 37.0 37.0 120-121 35.600875 37.0 37.0 37.0 37.0 37.0 122-123 35.56925 37.0 37.0 37.0 37.0 37.0 124-125 34.0565 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 0.0 16 2.0 17 0.0 18 1.0 19 0.0 20 0.0 21 3.0 22 1.0 23 5.0 24 4.0 25 6.0 26 4.0 27 14.0 28 22.0 29 23.0 30 26.0 31 50.0 32 66.0 33 90.0 34 138.0 35 258.0 36 3262.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.9122495561755 16.155211767689575 12.300278975399442 49.63225970073548 2 18.55 21.224999999999998 39.15 21.075 3 22.1 24.9 26.650000000000002 26.35 4 24.175 31.3 21.775 22.75 5 24.825 33.0 23.474999999999998 18.7 6 18.925 37.375 24.15 19.55 7 15.975 19.225 44.35 20.45 8 18.15 23.849999999999998 29.299999999999997 28.7 9 19.725 23.25 32.425 24.6 10-11 22.7125 33.0 22.775000000000002 21.512500000000003 12-13 19.950000000000003 27.175 29.812499999999996 23.0625 14-15 21.3875 28.000000000000004 28.4375 22.175 16-17 22.35 28.487499999999997 26.924999999999997 22.237499999999997 18-19 21.625 28.462500000000002 27.5875 22.325 20-21 21.85 29.275000000000002 26.5875 22.287499999999998 22-23 21.275 28.5625 28.15 22.0125 24-25 22.0 28.0875 28.5875 21.325 26-27 21.4125 28.475 28.249999999999996 21.8625 28-29 20.8625 28.237499999999997 28.287499999999998 22.6125 30-31 20.95 28.4125 27.8625 22.775000000000002 32-33 22.04576716268601 28.060522696011002 27.822933600100036 22.070776541202953 34-35 21.930482620655166 28.182045511377847 27.619404851212803 22.268067016754188 36-37 22.2125 27.8625 27.6 22.325 38-39 22.975 27.737499999999997 27.900000000000002 21.3875 40-41 21.512500000000003 28.8375 27.55 22.1 42-43 21.7 27.8875 28.012500000000003 22.400000000000002 44-45 21.875 28.575 28.050000000000004 21.5 46-47 21.85 28.325 27.5875 22.237499999999997 48-49 22.2625 27.987499999999997 27.750000000000004 22.0 50-51 22.425 28.375 27.500000000000004 21.7 52-53 23.0875 27.650000000000002 27.1625 22.1 54-55 21.5375 28.1 27.975 22.3875 56-57 22.0 27.962500000000002 27.8625 22.175 58-59 21.3125 29.525000000000002 27.125 22.037499999999998 60-61 21.6125 28.575 28.287499999999998 21.525 62-63 22.225 28.075 27.750000000000004 21.95 64-65 21.7 28.999999999999996 28.4125 20.8875 66-67 21.587500000000002 28.349999999999998 28.4125 21.65 68-69 22.4765478424015 28.167604752970604 28.19262038774234 21.163227016885553 70-71 21.425 28.125 27.175 23.275000000000002 72-73 21.7375 28.1 27.900000000000002 22.2625 74-75 21.9625 29.262500000000003 27.625 21.15 76-77 21.90273784223028 28.453556694586823 27.3284160520065 22.315289411176398 78-79 21.30081300813008 28.430268918073796 28.592870544090054 21.676047529706068 80-81 22.778473091364205 28.297872340425535 27.4468085106383 21.476846057571965 82-83 22.218054513628406 28.294573643410853 27.294323580895224 22.193048262065513 84-85 22.675 27.8125 26.8375 22.675 86-87 22.2625 28.7 27.0125 22.025 88-89 21.95 28.275 27.950000000000003 21.825 90-91 21.65 28.1625 27.800000000000004 22.3875 92-93 21.912499999999998 28.1375 28.262500000000003 21.6875 94-95 21.9 27.750000000000004 28.025 22.325 96-97 22.275 28.050000000000004 28.1 21.575 98-99 22.1 28.849999999999998 27.6 21.45 100-101 22.375 28.9125 27.8625 20.849999999999998 102-103 22.4375 27.55 27.750000000000004 22.2625 104-105 21.806580758163392 28.499937445264607 27.92443387964469 21.769047916927313 106-107 22.15411558669002 28.74655991993996 27.282962221666253 21.816362271703778 108-109 21.463414634146343 28.105065666041273 27.954971857410882 22.4765478424015 110-111 22.1875 28.1 28.000000000000004 21.712500000000002 112-113 22.7625 28.812500000000004 25.5625 22.8625 114-115 22.9875 28.9125 27.187499999999996 20.9125 116-117 22.775000000000002 28.6625 26.674999999999997 21.8875 118-119 23.150000000000002 29.049999999999997 26.3 21.5 120-121 23.3125 28.8875 26.5 21.3 122-123 23.2375 28.525 27.224999999999998 21.0125 124-125 23.150000000000002 28.487499999999997 26.487500000000004 21.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 3.0 25 5.5 26 7.0 27 8.5 28 10.5 29 13.5 30 18.5 31 24.5 32 35.5 33 45.0 34 55.0 35 74.0 36 96.5 37 116.0 38 132.5 39 150.5 40 188.0 41 225.0 42 237.5 43 256.5 44 278.0 45 282.5 46 275.5 47 242.5 48 208.0 49 187.0 50 169.0 51 158.5 52 121.0 53 85.0 54 62.5 55 44.5 56 37.0 57 27.0 58 22.0 59 18.0 60 13.5 61 10.0 62 8.0 63 8.0 64 7.0 65 4.5 66 3.5 67 6.0 68 5.0 69 3.0 70 2.5 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0375 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0625 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0625 80-81 0.125 82-83 0.025 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.08750000000000001 106-107 0.075 108-109 0.0625 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1625 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.45 0.0 0.0 0.0 0.0 108-109 2.9375 0.0 0.0 0.0 0.0 110-111 3.4625000000000004 0.0 0.0 0.0 0.0 112-113 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529852 spots for SRR3208058.sra Written 529852 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra Read 529845 spots for SRR3208058.sra Written 529845 spots for SRR3208058.sra SRR ids: ['SRR3208058.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ax2mjqv5 SRR3208058.sra spots: 10596907 blocks: [[1, 529845], [529846, 1059690], [1059691, 1589535], [1589536, 2119380], [2119381, 2649225], [2649226, 3179070], [3179071, 3708915], [3708916, 4238760], [4238761, 4768605], [4768606, 5298450], [5298451, 5828295], [5828296, 6358140], [6358141, 6887985], [6887986, 7417830], [7417831, 7947675], [7947676, 8477520], [8477521, 9007365], [9007366, 9537210], [9537211, 10067055], [10067056, 10596907]] SRR3208058 file size 3388644 SRR3208058 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208058 SRR3208058_1.fastq Input file: SRR3208058_1.fastq trimmed: SRR3208058-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:52:43 2025 >> started Wed Feb 12 04:52:51 2025 >> done (8.580s) 10596907 reads processed; of these: 7970 ( 0.08%) short reads filtered out after trimming by size control 33595 ( 0.32%) empty reads filtered out after trimming by size control 10555342 (99.61%) reads available; of these: 1203960 (11.41%) trimmed reads available after processing 9351382 (88.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 390 0.00% 19 351 0.00% 20 381 0.00% 21 398 0.00% 22 415 0.00% 23 489 0.00% 24 565 0.01% 25 677 0.01% 26 639 0.01% 27 583 0.01% 28 635 0.01% 29 684 0.01% 30 985 0.01% 31 1235 0.01% 32 606 0.01% 33 526 0.00% 34 563 0.01% 35 576 0.01% 36 563 0.01% 37 540 0.01% 38 562 0.01% 39 562 0.01% 40 611 0.01% 41 596 0.01% 42 558 0.01% 43 663 0.01% 44 623 0.01% 45 611 0.01% 46 690 0.01% 47 601 0.01% 48 610 0.01% 49 628 0.01% 50 610 0.01% 51 734 0.01% 52 737 0.01% 53 610 0.01% 54 725 0.01% 55 763 0.01% 56 802 0.01% 57 760 0.01% 58 807 0.01% 59 843 0.01% 60 885 0.01% 61 904 0.01% 62 908 0.01% 63 932 0.01% 64 965 0.01% 65 1016 0.01% 66 980 0.01% 67 1053 0.01% 68 1031 0.01% 69 1101 0.01% 70 1203 0.01% 71 1162 0.01% 72 1278 0.01% 73 1363 0.01% 74 1446 0.01% 75 1572 0.01% 76 1809 0.02% 77 1662 0.02% 78 1829 0.02% 79 1969 0.02% 80 2092 0.02% 81 2347 0.02% 82 2550 0.02% 83 2783 0.03% 84 3010 0.03% 85 3347 0.03% 86 3524 0.03% 87 3836 0.04% 88 4435 0.04% 89 4905 0.05% 90 5548 0.05% 91 6315 0.06% 92 7549 0.07% 93 7629 0.07% 94 1566 0.01% 95 1665 0.02% 96 1809 0.02% 97 1950 0.02% 98 1974 0.02% 99 2104 0.02% 100 2204 0.02% 101 2265 0.02% 102 2504 0.02% 103 2512 0.02% 104 2738 0.03% 105 2946 0.03% 106 3095 0.03% 107 3315 0.03% 108 3771 0.04% 109 4095 0.04% 110 4398 0.04% 111 5089 0.05% 112 5633 0.05% 113 6295 0.06% 114 7333 0.07% 115 8522 0.08% 116 9899 0.09% 117 11983 0.11% 118 15479 0.15% 119 20270 0.19% 120 27732 0.26% 121 57417 0.54% 122 62527 0.59% 123 147597 1.40% 124 661828 6.27% 125 9351382 88.59% 10555342 reads passed initial QC criterion=sequence-density sequence-density=3.75 sequence-density-rank=1 fanout-score=49.89 fanout-score-rank=1 prefix-density=5.17 prefix-fanout=36.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGC criterion=fanout-score sequence-density=3.75 sequence-density-rank=1 fanout-score=49.89 fanout-score-rank=1 prefix-density=5.17 prefix-fanout=36.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGC -o SRR3208058 - Input file: STDIN trimmed: SRR3208058-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:53:22 2025 >> started Wed Feb 12 04:53:30 2025 >> done (7.972s) 5277671 reads processed; of these: 64 ( 0.00%) short reads filtered out after trimming by size control 327 ( 0.01%) empty reads filtered out after trimming by size control 5277280 (99.99%) reads available; of these: 643179 (12.19%) trimmed reads available after processing 4634101 (87.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 183 0.00% 19 172 0.00% 20 201 0.00% 21 210 0.00% 22 221 0.00% 23 247 0.00% 24 297 0.01% 25 359 0.01% 26 310 0.01% 27 288 0.01% 28 337 0.01% 29 364 0.01% 30 465 0.01% 31 609 0.01% 32 303 0.01% 33 256 0.00% 34 282 0.01% 35 285 0.01% 36 274 0.01% 37 247 0.00% 38 282 0.01% 39 292 0.01% 40 320 0.01% 41 319 0.01% 42 271 0.01% 43 320 0.01% 44 304 0.01% 45 299 0.01% 46 323 0.01% 47 308 0.01% 48 317 0.01% 49 303 0.01% 50 293 0.01% 51 366 0.01% 52 338 0.01% 53 302 0.01% 54 375 0.01% 55 364 0.01% 56 410 0.01% 57 388 0.01% 58 395 0.01% 59 422 0.01% 60 432 0.01% 61 495 0.01% 62 449 0.01% 63 487 0.01% 64 469 0.01% 65 504 0.01% 66 480 0.01% 67 551 0.01% 68 510 0.01% 69 562 0.01% 70 605 0.01% 71 576 0.01% 72 628 0.01% 73 674 0.01% 74 691 0.01% 75 727 0.01% 76 779 0.01% 77 840 0.02% 78 943 0.02% 79 965 0.02% 80 1020 0.02% 81 1164 0.02% 82 1302 0.02% 83 1374 0.03% 84 1523 0.03% 85 1665 0.03% 86 1747 0.03% 87 1947 0.04% 88 2298 0.04% 89 2552 0.05% 90 2778 0.05% 91 3223 0.06% 92 3822 0.07% 93 4147 0.08% 94 4569 0.09% 95 5078 0.10% 96 5606 0.11% 97 5973 0.11% 98 6673 0.13% 99 7547 0.14% 100 8707 0.16% 101 9621 0.18% 102 10958 0.21% 103 12187 0.23% 104 13553 0.26% 105 14296 0.27% 106 15186 0.29% 107 16431 0.31% 108 17327 0.33% 109 18181 0.34% 110 20103 0.38% 111 22350 0.42% 112 24857 0.47% 113 27039 0.51% 114 29762 0.56% 115 31339 0.59% 116 32513 0.62% 117 33897 0.64% 118 36621 0.69% 119 40719 0.77% 120 52174 0.99% 121 86851 1.65% 122 163285 3.09% 123 67129 1.27% 124 300405 5.69% 125 4080193 77.32% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=5.18 fanout-score-rank=16 prefix-density=0.11 prefix-fanout=3.3 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=291.96 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=29.4 sequence=TTCTTCTTCTTT Started job on | Feb 12 04:53:53 Started mapping on | Feb 12 04:53:54 Finished on | Feb 12 04:54:11 Mapping speed, Million of reads per hour | 2235.17 Number of input reads | 10554951 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 9805046 Uniquely mapped reads % | 92.90% Average mapped length | 122.72 Number of splices: Total | 3679886 Number of splices: Annotated (sjdb) | 3608931 Number of splices: GT/AG | 3622454 Number of splices: GC/AG | 46586 Number of splices: AT/AC | 3866 Number of splices: Non-canonical | 6980 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.13 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 222171 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 343291 % of reads mapped to too many loci | 3.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.73% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 527734 527734 527734 N_multimapping 222171 222171 222171 N_noFeature 421337 5078561 5079486 N_ambiguous 104889 18306 18424 UnstrandedReadsAssigned:9278820 PositiveStrandReadsAssigned:4708179 NegativeStrandReadsAssigned:4707136 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208058 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208058-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,554,951 reads, 9,769,164 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR3208058.ke.tsv 34699 SRR3208058.se.tsv 87100 total ==> SRR3208058.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 304 23.0965 Potri.005G024800.1.v4.1 1035 936 44 6.85369 Potri.004G059700.1.v4.1 961 862 10 1.69138 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 172.096 8.82243 Potri.016G087400.1.v4.1 270 171 432 368.328 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 38 3.3096 Potri.012G127500.1.v4.1 977 878 1799 298.734 ==> SRR3208058.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1032 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 201 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3208058 completed mapping pipeline successfully