Starting /dee2/code/volunteer_pipeline.sh SRR3208059 current disk space = 3049208283136 free memory = 1570700376 SRR3208059 SRAfilesize b2bce04b9c2d88aaa218c75d18ebcef8 SRR3208059.sra SRR3208059.sra file validated SRR3208059 is single end SRR3208059 is conventional basespace SRR3208059 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208059_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.98125 33.0 33.0 33.0 33.0 33.0 2 32.2725 33.0 33.0 33.0 33.0 33.0 3 32.34675 33.0 33.0 33.0 33.0 33.0 4 32.38725 33.0 33.0 33.0 33.0 33.0 5 32.38 33.0 33.0 33.0 33.0 33.0 6 36.12675 37.0 37.0 37.0 37.0 37.0 7 36.15025 37.0 37.0 37.0 37.0 37.0 8 36.3 37.0 37.0 37.0 37.0 37.0 9 36.2945 37.0 37.0 37.0 37.0 37.0 10-11 36.263875 37.0 37.0 37.0 37.0 37.0 12-13 36.316625 37.0 37.0 37.0 37.0 37.0 14-15 36.289375 37.0 37.0 37.0 37.0 37.0 16-17 36.27425 37.0 37.0 37.0 37.0 37.0 18-19 36.29075 37.0 37.0 37.0 37.0 37.0 20-21 36.27775 37.0 37.0 37.0 37.0 37.0 22-23 36.308875 37.0 37.0 37.0 37.0 37.0 24-25 36.2945 37.0 37.0 37.0 37.0 37.0 26-27 36.33025 37.0 37.0 37.0 37.0 37.0 28-29 36.262375 37.0 37.0 37.0 37.0 37.0 30-31 36.249125 37.0 37.0 37.0 37.0 37.0 32-33 36.30325 37.0 37.0 37.0 37.0 37.0 34-35 36.269999999999996 37.0 37.0 37.0 37.0 37.0 36-37 36.2645 37.0 37.0 37.0 37.0 37.0 38-39 36.233000000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.22925 37.0 37.0 37.0 37.0 37.0 42-43 36.284125 37.0 37.0 37.0 37.0 37.0 44-45 36.2635 37.0 37.0 37.0 37.0 37.0 46-47 36.2665 37.0 37.0 37.0 37.0 37.0 48-49 36.229375000000005 37.0 37.0 37.0 37.0 37.0 50-51 36.215125 37.0 37.0 37.0 37.0 37.0 52-53 36.20325 37.0 37.0 37.0 37.0 37.0 54-55 36.220625 37.0 37.0 37.0 37.0 37.0 56-57 36.189 37.0 37.0 37.0 37.0 37.0 58-59 36.154250000000005 37.0 37.0 37.0 37.0 37.0 60-61 36.1775 37.0 37.0 37.0 37.0 37.0 62-63 36.15375 37.0 37.0 37.0 37.0 37.0 64-65 36.167625 37.0 37.0 37.0 37.0 37.0 66-67 36.164625 37.0 37.0 37.0 37.0 37.0 68-69 36.196250000000006 37.0 37.0 37.0 37.0 37.0 70-71 36.142875000000004 37.0 37.0 37.0 37.0 37.0 72-73 36.135999999999996 37.0 37.0 37.0 37.0 37.0 74-75 36.109750000000005 37.0 37.0 37.0 37.0 37.0 76-77 36.075375 37.0 37.0 37.0 37.0 37.0 78-79 36.133624999999995 37.0 37.0 37.0 37.0 37.0 80-81 36.138 37.0 37.0 37.0 37.0 37.0 82-83 36.1305 37.0 37.0 37.0 37.0 37.0 84-85 36.1575 37.0 37.0 37.0 37.0 37.0 86-87 36.027125 37.0 37.0 37.0 37.0 37.0 88-89 36.030249999999995 37.0 37.0 37.0 37.0 37.0 90-91 36.005624999999995 37.0 37.0 37.0 37.0 37.0 92-93 35.984625 37.0 37.0 37.0 37.0 37.0 94-95 36.02825 37.0 37.0 37.0 37.0 37.0 96-97 35.956625 37.0 37.0 37.0 37.0 37.0 98-99 35.9745 37.0 37.0 37.0 37.0 37.0 100-101 35.93625 37.0 37.0 37.0 37.0 37.0 102-103 35.915125 37.0 37.0 37.0 37.0 37.0 104-105 35.8955 37.0 37.0 37.0 37.0 37.0 106-107 35.9345 37.0 37.0 37.0 37.0 37.0 108-109 35.863125 37.0 37.0 37.0 37.0 37.0 110-111 35.8885 37.0 37.0 37.0 37.0 37.0 112-113 35.831875 37.0 37.0 37.0 37.0 37.0 114-115 35.8715 37.0 37.0 37.0 37.0 37.0 116-117 35.760999999999996 37.0 37.0 37.0 37.0 37.0 118-119 35.81225 37.0 37.0 37.0 37.0 37.0 120-121 35.714375000000004 37.0 37.0 37.0 37.0 37.0 122-123 35.613749999999996 37.0 37.0 37.0 37.0 37.0 124-125 34.022625000000005 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 4.0 12 1.0 13 0.0 14 2.0 15 0.0 16 0.0 17 0.0 18 0.0 19 3.0 20 0.0 21 3.0 22 0.0 23 6.0 24 4.0 25 8.0 26 12.0 27 9.0 28 19.0 29 13.0 30 18.0 31 43.0 32 44.0 33 75.0 34 118.0 35 234.0 36 3355.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.43816254416961 16.58253407370015 12.670368500757192 48.30893488137305 2 18.099999999999998 21.9 40.425 19.575 3 20.599999999999998 26.650000000000002 28.15 24.6 4 22.650000000000002 30.875000000000004 23.325000000000003 23.150000000000002 5 24.7 34.625 23.3 17.375 6 18.25 36.199999999999996 24.325 21.224999999999998 7 16.35 18.224999999999998 44.824999999999996 20.599999999999998 8 18.7 22.6 30.975 27.725 9 19.2 23.3 31.8 25.7 10-11 22.3 33.4375 23.95 20.3125 12-13 20.5 26.75 30.275000000000002 22.475 14-15 21.825 28.487499999999997 28.1375 21.55 16-17 21.425 28.3625 27.625 22.5875 18-19 21.637500000000003 29.049999999999997 26.900000000000002 22.412499999999998 20-21 21.9 28.5625 27.975 21.5625 22-23 22.3125 27.85 27.987499999999997 21.85 24-25 22.237499999999997 27.925 27.6875 22.15 26-27 21.85 28.349999999999998 28.7 21.099999999999998 28-29 21.912499999999998 27.725 27.900000000000002 22.4625 30-31 21.475 28.95 28.000000000000004 21.575 32-33 21.930482620655166 28.81970492623156 27.46936734183546 21.780445111277817 34-35 22.127765970746342 27.69096137017127 28.028503562945367 22.152769096137018 36-37 21.552694086760845 28.86610826353294 27.703462932866607 21.877734716839605 38-39 22.2 28.349999999999998 26.900000000000002 22.55 40-41 22.1375 28.537499999999998 27.712500000000002 21.6125 42-43 21.825 27.3625 28.299999999999997 22.5125 44-45 21.7875 28.1625 27.712500000000002 22.3375 46-47 21.65 28.3875 27.500000000000004 22.4625 48-49 21.512500000000003 28.325 28.012500000000003 22.15 50-51 21.4 28.3375 28.050000000000004 22.2125 52-53 21.75 29.025000000000002 26.637499999999996 22.5875 54-55 21.2875 28.487499999999997 28.15 22.075 56-57 21.2875 29.075 26.950000000000003 22.6875 58-59 21.475 28.9 27.725 21.9 60-61 21.325 29.062500000000004 27.6625 21.95 62-63 21.587500000000002 28.825 27.675 21.912499999999998 64-65 22.3125 28.1125 27.825 21.75 66-67 22.2125 27.675 27.925 22.1875 68-69 22.15 28.6125 27.474999999999998 21.762500000000003 70-71 21.775 27.55 28.725 21.95 72-73 21.462500000000002 28.787499999999998 28.075 21.675 74-75 22.35 27.5875 28.037499999999998 22.025 76-77 22.0 27.6 28.0625 22.3375 78-79 21.912499999999998 28.225 27.575 22.287499999999998 80-81 21.712500000000002 28.025 27.925 22.3375 82-83 21.4375 29.2875 27.375 21.9 84-85 21.6625 28.7 27.712500000000002 21.925 86-87 22.6875 28.012500000000003 27.950000000000003 21.349999999999998 88-89 22.412499999999998 28.4375 27.175 21.975 90-91 21.912499999999998 28.749999999999996 27.625 21.712500000000002 92-93 22.45 27.787499999999998 27.925 21.837500000000002 94-95 22.1375 27.737499999999997 28.0625 22.0625 96-97 22.662499999999998 28.025 27.287499999999998 22.025 98-99 22.575 28.3125 27.700000000000003 21.4125 100-101 21.912499999999998 28.599999999999998 27.0 22.4875 102-103 22.4375 28.875 27.037499999999998 21.65 104-105 22.237499999999997 29.862499999999997 26.724999999999998 21.175 106-107 21.6875 29.562500000000004 27.474999999999998 21.275 108-109 21.837500000000002 28.849999999999998 27.2625 22.05 110-111 22.8375 28.599999999999998 26.4125 22.15 112-113 22.3875 28.9875 28.0875 20.5375 114-115 23.0125 28.7375 25.912499999999998 22.3375 116-117 22.537499999999998 28.962500000000002 26.825 21.675 118-119 22.825 29.425 26.3 21.45 120-121 23.65 28.6375 26.400000000000002 21.3125 122-123 23.3875 28.8375 26.8 20.974999999999998 124-125 22.8875 29.975 25.85 21.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 3.0 26 5.0 27 8.0 28 11.5 29 14.5 30 16.0 31 22.0 32 27.5 33 37.0 34 61.0 35 81.0 36 86.5 37 113.5 38 149.5 39 170.0 40 203.5 41 229.5 42 252.0 43 270.0 44 286.5 45 284.0 46 262.5 47 239.5 48 205.5 49 175.5 50 150.5 51 138.0 52 117.0 53 80.5 54 57.5 55 57.5 56 42.5 57 23.0 58 22.0 59 22.0 60 16.0 61 10.0 62 9.0 63 7.0 64 4.0 65 4.5 66 4.0 67 3.0 68 2.0 69 0.5 70 1.0 71 1.0 72 1.5 73 2.0 74 1.0 75 1.0 76 1.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.025 34-35 0.0125 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.1749999999999998 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.5875000000000004 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.6875 0.0 0.0 0.0 0.0 110-111 4.612500000000001 0.0 0.0 0.0 0.0 112-113 5.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419766 spots for SRR3208059.sra Written 419766 spots for SRR3208059.sra Read 419776 spots for SRR3208059.sra Written 419776 spots for SRR3208059.sra SRR ids: ['SRR3208059.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pwiu4mfp SRR3208059.sra spots: 8395330 blocks: [[1, 419766], [419767, 839532], [839533, 1259298], [1259299, 1679064], [1679065, 2098830], [2098831, 2518596], [2518597, 2938362], [2938363, 3358128], [3358129, 3777894], [3777895, 4197660], [4197661, 4617426], [4617427, 5037192], [5037193, 5456958], [5456959, 5876724], [5876725, 6296490], [6296491, 6716256], [6716257, 7136022], [7136023, 7555788], [7555789, 7975554], [7975555, 8395330]] SRR3208059 file size 2683920 SRR3208059 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208059 SRR3208059_1.fastq Input file: SRR3208059_1.fastq trimmed: SRR3208059-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:29:57 2025 >> started Wed Feb 12 04:30:02 2025 >> done (4.861s) 8395330 reads processed; of these: 6767 ( 0.08%) short reads filtered out after trimming by size control 30900 ( 0.37%) empty reads filtered out after trimming by size control 8357663 (99.55%) reads available; of these: 928813 (11.11%) trimmed reads available after processing 7428850 (88.89%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 270 0.00% 19 296 0.00% 20 280 0.00% 21 291 0.00% 22 363 0.00% 23 404 0.00% 24 410 0.00% 25 500 0.01% 26 452 0.01% 27 446 0.01% 28 438 0.01% 29 544 0.01% 30 770 0.01% 31 809 0.01% 32 460 0.01% 33 425 0.01% 34 431 0.01% 35 443 0.01% 36 435 0.01% 37 412 0.00% 38 418 0.01% 39 459 0.01% 40 444 0.01% 41 442 0.01% 42 457 0.01% 43 455 0.01% 44 484 0.01% 45 491 0.01% 46 499 0.01% 47 480 0.01% 48 551 0.01% 49 509 0.01% 50 539 0.01% 51 529 0.01% 52 566 0.01% 53 592 0.01% 54 525 0.01% 55 578 0.01% 56 588 0.01% 57 618 0.01% 58 609 0.01% 59 685 0.01% 60 691 0.01% 61 703 0.01% 62 697 0.01% 63 724 0.01% 64 708 0.01% 65 739 0.01% 66 759 0.01% 67 768 0.01% 68 875 0.01% 69 862 0.01% 70 929 0.01% 71 1017 0.01% 72 1073 0.01% 73 1128 0.01% 74 1155 0.01% 75 1237 0.01% 76 1357 0.02% 77 1401 0.02% 78 1482 0.02% 79 1740 0.02% 80 1797 0.02% 81 2054 0.02% 82 2437 0.03% 83 2608 0.03% 84 2805 0.03% 85 3066 0.04% 86 3306 0.04% 87 3601 0.04% 88 4114 0.05% 89 4710 0.06% 90 5490 0.07% 91 6205 0.07% 92 7119 0.09% 93 7778 0.09% 94 1282 0.02% 95 1311 0.02% 96 1380 0.02% 97 1449 0.02% 98 1406 0.02% 99 1530 0.02% 100 1777 0.02% 101 1834 0.02% 102 1899 0.02% 103 1938 0.02% 104 2140 0.03% 105 2223 0.03% 106 2255 0.03% 107 2639 0.03% 108 2745 0.03% 109 3065 0.04% 110 3358 0.04% 111 3861 0.05% 112 4189 0.05% 113 4891 0.06% 114 5640 0.07% 115 6323 0.08% 116 7292 0.09% 117 8987 0.11% 118 11183 0.13% 119 14711 0.18% 120 19431 0.23% 121 27150 0.32% 122 46592 0.56% 123 128967 1.54% 124 507833 6.08% 125 7428850 88.89% 8357663 reads passed initial QC criterion=sequence-density sequence-density=4.60 sequence-density-rank=1 fanout-score=48.48 fanout-score-rank=1 prefix-density=6.21 prefix-fanout=35.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATGC criterion=fanout-score sequence-density=4.60 sequence-density-rank=1 fanout-score=48.48 fanout-score-rank=1 prefix-density=6.21 prefix-fanout=35.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATGC -o SRR3208059 - Input file: STDIN trimmed: SRR3208059-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:30:54 2025 >> started Wed Feb 12 04:31:00 2025 >> done (5.339s) 5014598 reads processed; of these: 53 ( 0.00%) short reads filtered out after trimming by size control 198 ( 0.00%) empty reads filtered out after trimming by size control 5014347 (99.99%) reads available; of these: 687838 (13.72%) trimmed reads available after processing 4326509 (86.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 165 0.00% 19 179 0.00% 20 170 0.00% 21 178 0.00% 22 210 0.00% 23 233 0.00% 24 243 0.00% 25 319 0.01% 26 276 0.01% 27 273 0.01% 28 258 0.01% 29 328 0.01% 30 450 0.01% 31 477 0.01% 32 260 0.01% 33 260 0.01% 34 267 0.01% 35 297 0.01% 36 254 0.01% 37 257 0.01% 38 247 0.00% 39 296 0.01% 40 270 0.01% 41 251 0.01% 42 263 0.01% 43 267 0.01% 44 271 0.01% 45 285 0.01% 46 298 0.01% 47 308 0.01% 48 305 0.01% 49 298 0.01% 50 311 0.01% 51 305 0.01% 52 342 0.01% 53 343 0.01% 54 314 0.01% 55 347 0.01% 56 343 0.01% 57 380 0.01% 58 379 0.01% 59 396 0.01% 60 425 0.01% 61 436 0.01% 62 406 0.01% 63 457 0.01% 64 410 0.01% 65 434 0.01% 66 442 0.01% 67 469 0.01% 68 537 0.01% 69 530 0.01% 70 588 0.01% 71 604 0.01% 72 635 0.01% 73 679 0.01% 74 663 0.01% 75 724 0.01% 76 758 0.02% 77 840 0.02% 78 894 0.02% 79 1074 0.02% 80 1061 0.02% 81 1234 0.02% 82 1443 0.03% 83 1578 0.03% 84 1715 0.03% 85 1770 0.04% 86 2052 0.04% 87 2236 0.04% 88 2490 0.05% 89 2863 0.06% 90 3307 0.07% 91 3691 0.07% 92 4294 0.09% 93 4720 0.09% 94 5393 0.11% 95 6054 0.12% 96 6452 0.13% 97 7095 0.14% 98 7864 0.16% 99 8464 0.17% 100 9997 0.20% 101 11190 0.22% 102 12590 0.25% 103 13947 0.28% 104 15331 0.31% 105 16252 0.32% 106 17101 0.34% 107 18144 0.36% 108 19124 0.38% 109 20489 0.41% 110 22673 0.45% 111 24827 0.50% 112 27364 0.55% 113 29653 0.59% 114 31397 0.63% 115 32973 0.66% 116 34728 0.69% 117 35725 0.71% 118 37955 0.76% 119 42010 0.84% 120 51406 1.03% 121 74253 1.48% 122 154233 3.08% 123 68509 1.37% 124 273477 5.45% 125 3819045 76.16% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=34 prefix-density=0.08 prefix-fanout=2.7 sequence=GGTGCAAAGATGGTTA criterion=fanout-score sequence-density=0.05 sequence-density-rank=15 fanout-score=297.40 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=29.8 sequence=TTCTTCTTCTTT Started job on | Feb 12 04:31:21 Started mapping on | Feb 12 04:31:22 Finished on | Feb 12 04:31:34 Mapping speed, Million of reads per hour | 2507.22 Number of input reads | 8357412 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 7931502 Uniquely mapped reads % | 94.90% Average mapped length | 122.47 Number of splices: Total | 2925696 Number of splices: Annotated (sjdb) | 2868529 Number of splices: GT/AG | 2880617 Number of splices: GC/AG | 36601 Number of splices: AT/AC | 3116 Number of splices: Non-canonical | 5362 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 167720 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 160364 % of reads mapped to too many loci | 1.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 258190 258190 258190 N_multimapping 167720 167720 167720 N_noFeature 348072 4105791 4112825 N_ambiguous 90036 14526 14699 UnstrandedReadsAssigned:7493394 PositiveStrandReadsAssigned:3811185 NegativeStrandReadsAssigned:3803978 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208059 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208059-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,357,412 reads, 7,776,485 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52401 SRR3208059.ke.tsv 34699 SRR3208059.se.tsv 87100 total ==> SRR3208059.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 265 25.3161 Potri.005G024800.1.v4.1 1035 936 42 8.22621 Potri.004G059700.1.v4.1 961 862 20 4.25353 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 146.162 9.42175 Potri.016G087400.1.v4.1 270 171 328 351.645 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 21 2.2998 Potri.012G127500.1.v4.1 977 878 1174 245.132 ==> SRR3208059.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 707 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 174 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3208059 completed mapping pipeline successfully