Starting /dee2/code/volunteer_pipeline.sh SRR3208061 current disk space = 3049122226176 free memory = 1433311604 SRR3208061 SRAfilesize 4dce87bb937793394c7509a26a44c91a SRR3208061.sra SRR3208061.sra file validated SRR3208061 is single end SRR3208061 is conventional basespace SRR3208061 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208061_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.00925 33.0 33.0 34.0 30.0 34.0 2 32.3135 33.0 33.0 34.0 30.0 34.0 3 32.25075 33.0 33.0 34.0 30.0 34.0 4 31.91775 33.0 32.0 34.0 28.0 34.0 5 32.14175 33.0 33.0 34.0 30.0 34.0 6 35.7915 38.0 36.0 38.0 31.0 38.0 7 36.17725 38.0 37.0 38.0 33.0 38.0 8 36.25725 38.0 37.0 38.0 33.0 38.0 9 36.398 38.0 37.0 38.0 34.0 38.0 10-11 36.423 38.0 38.0 38.0 34.0 38.0 12-13 36.358374999999995 38.0 37.5 38.0 33.0 38.0 14-15 36.413875000000004 38.0 38.0 38.0 34.0 38.0 16-17 36.463125 38.0 38.0 38.0 33.5 38.0 18-19 36.382999999999996 38.0 38.0 38.0 33.5 38.0 20-21 36.424499999999995 38.0 38.0 38.0 33.5 38.0 22-23 36.338125000000005 38.0 38.0 38.0 33.5 38.0 24-25 36.357124999999996 38.0 38.0 38.0 34.0 38.0 26-27 36.185625 38.0 37.0 38.0 33.0 38.0 28-29 36.282625 38.0 37.5 38.0 33.0 38.0 30-31 36.293125 38.0 38.0 38.0 33.5 38.0 32-33 36.3945 38.0 38.0 38.0 34.0 38.0 34-35 36.344375 38.0 38.0 38.0 33.5 38.0 36-37 36.231125000000006 38.0 37.5 38.0 33.5 38.0 38-39 36.289874999999995 38.0 38.0 38.0 33.5 38.0 40-41 36.302 38.0 38.0 38.0 33.5 38.0 42-43 36.309875000000005 38.0 38.0 38.0 33.5 38.0 44-45 36.317375 38.0 38.0 38.0 33.5 38.0 46-47 36.293125 38.0 38.0 38.0 33.5 38.0 48-49 36.1425 38.0 37.5 38.0 32.0 38.0 50-51 36.26349999999999 38.0 37.5 38.0 33.0 38.0 52-53 36.366625 38.0 38.0 38.0 34.0 38.0 54-55 36.41375 38.0 38.0 38.0 34.0 38.0 56-57 36.37175 38.0 38.0 38.0 33.5 38.0 58-59 36.329499999999996 38.0 38.0 38.0 33.5 38.0 60-61 36.390125 38.0 38.0 38.0 33.5 38.0 62-63 36.27625 38.0 37.5 38.0 33.0 38.0 64-65 36.250375000000005 38.0 38.0 38.0 33.0 38.0 66-67 36.195875 38.0 37.5 38.0 33.5 38.0 68-69 36.355625 38.0 38.0 38.0 33.5 38.0 70-71 36.3745 38.0 38.0 38.0 34.0 38.0 72-73 36.257125 38.0 38.0 38.0 34.0 38.0 74-75 36.050375 38.0 37.5 38.0 33.0 38.0 76-77 35.9435 38.0 37.0 38.0 33.0 38.0 78-79 36.03175 38.0 37.0 38.0 33.0 38.0 80-81 36.130250000000004 38.0 37.0 38.0 33.5 38.0 82-83 36.05475 38.0 37.5 38.0 33.0 38.0 84-85 36.007999999999996 38.0 37.5 38.0 32.5 38.0 86-87 36.07725 38.0 37.5 38.0 33.0 38.0 88-89 35.8945 38.0 37.0 38.0 32.0 38.0 90-91 35.955625 38.0 37.0 38.0 33.0 38.0 92-93 35.921125 38.0 37.0 38.0 32.5 38.0 94-95 35.969750000000005 38.0 37.0 38.0 33.0 38.0 96-97 35.823375 38.0 37.0 38.0 32.0 38.0 98-99 35.832625 38.0 37.0 38.0 33.0 38.0 100-101 35.838750000000005 38.0 37.0 38.0 31.5 38.0 102-103 35.802 38.0 37.0 38.0 32.0 38.0 104-105 35.807249999999996 38.0 37.0 38.0 33.0 38.0 106-107 35.667 38.0 37.0 38.0 31.0 38.0 108-109 35.5225 38.0 37.0 38.0 31.0 38.0 110-111 35.476625 38.0 37.0 38.0 31.0 38.0 112-113 35.337 38.0 37.0 38.0 30.0 38.0 114-115 35.45725 38.0 37.0 38.0 31.0 38.0 116-117 35.378375 38.0 37.0 38.0 31.0 38.0 118-119 35.402125 38.0 37.0 38.0 31.0 38.0 120-121 35.106125 38.0 36.5 38.0 29.5 38.0 122-123 35.230374999999995 38.0 37.0 38.0 31.0 38.0 124-125 33.599000000000004 37.5 34.5 38.0 23.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 2.0 18 0.0 19 3.0 20 6.0 21 8.0 22 17.0 23 9.0 24 4.0 25 16.0 26 28.0 27 32.0 28 32.0 29 48.0 30 74.0 31 96.0 32 133.0 33 178.0 34 212.0 35 284.0 36 493.0 37 2313.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.35012594458438 15.768261964735517 10.856423173803528 50.02518891687657 2 18.479619904976243 21.10527631907977 39.709927481870466 20.705176294073517 3 20.125 25.924999999999997 29.349999999999998 24.6 4 23.95 29.825000000000003 21.725 24.5 5 24.7 32.475 23.65 19.175 6 19.5 36.525 24.825 19.15 7 17.974999999999998 19.225 42.6 20.200000000000003 8 18.35 23.974999999999998 30.475 27.200000000000003 9 19.525000000000002 23.05 32.7 24.725 10-11 22.3875 33.037499999999994 23.0875 21.4875 12-13 20.075000000000003 27.537499999999998 29.175 23.2125 14-15 20.875 27.712500000000002 28.349999999999998 23.0625 16-17 22.25 28.249999999999996 26.85 22.650000000000002 18-19 20.7875 28.15 28.199999999999996 22.8625 20-21 21.65 28.487499999999997 27.900000000000002 21.9625 22-23 21.9625 29.549999999999997 27.1125 21.375 24-25 21.4 28.6625 27.650000000000002 22.287499999999998 26-27 21.6125 27.037499999999998 28.012500000000003 23.3375 28-29 21.1125 28.775000000000002 27.650000000000002 22.4625 30-31 21.025 28.449999999999996 28.3375 22.1875 32-33 21.2625 28.712500000000002 27.8625 22.162499999999998 34-35 21.6 28.8875 27.487499999999997 22.025 36-37 20.962500000000002 28.762500000000003 28.0625 22.2125 38-39 22.075 28.6625 27.6375 21.625 40-41 21.4125 28.449999999999996 27.900000000000002 22.237499999999997 42-43 21.0625 27.8625 28.287499999999998 22.787499999999998 44-45 21.4875 28.000000000000004 28.3375 22.175 46-47 22.112499999999997 28.1625 28.299999999999997 21.425 48-49 21.3125 28.3625 28.0625 22.2625 50-51 21.4125 27.8375 27.775 22.975 52-53 21.8625 28.375 27.5125 22.25 54-55 21.4375 27.700000000000003 29.512500000000003 21.349999999999998 56-57 22.275 27.962500000000002 27.825 21.9375 58-59 22.3875 28.000000000000004 27.787499999999998 21.825 60-61 20.7875 27.0125 28.95 23.25 62-63 21.462500000000002 28.487499999999997 28.3375 21.712500000000002 64-65 21.2875 28.849999999999998 27.762500000000003 22.1 66-67 22.225 28.749999999999996 27.737499999999997 21.2875 68-69 21.6625 28.9 27.537499999999998 21.9 70-71 21.8875 29.312500000000004 27.0625 21.7375 72-73 20.7625 28.375 28.475 22.3875 74-75 22.3875 27.55 27.375 22.6875 76-77 21.575 28.1625 27.950000000000003 22.3125 78-79 22.225 27.9125 28.075 21.7875 80-81 21.212500000000002 28.462500000000002 27.762500000000003 22.5625 82-83 20.95 28.4125 28.487499999999997 22.15 84-85 21.4125 27.3625 28.775000000000002 22.45 86-87 22.025 28.537499999999998 27.625 21.8125 88-89 21.55 27.750000000000004 28.5625 22.1375 90-91 22.0 27.1625 28.65 22.1875 92-93 20.7125 28.3375 29.099999999999998 21.85 94-95 21.349999999999998 28.0625 28.5625 22.025 96-97 21.587500000000002 28.487499999999997 28.925 21.0 98-99 22.3375 28.275 27.5875 21.8 100-101 20.8125 28.875 28.037499999999998 22.275 102-103 21.65 28.537499999999998 27.8375 21.975 104-105 22.4625 27.975 28.65 20.9125 106-107 22.02328784274446 27.707524727682486 27.907850256667082 22.361337172905973 108-109 21.821608040201003 29.208542713567837 27.14824120603015 21.821608040201003 110-111 23.013182674199623 28.424356559949782 27.658505963590706 20.903954802259886 112-113 23.757392726815148 28.790738643513276 26.739650182458792 20.712218447212784 114-115 22.64458662652114 28.101869276125957 27.1107765650483 22.142767532304607 116-117 22.144376329288125 28.90028775178281 26.98611284874265 21.969223070186413 118-119 22.912499999999998 28.5625 26.8625 21.6625 120-121 23.474999999999998 28.175 27.3125 21.0375 122-123 23.6125 27.925 27.025 21.4375 124-125 22.9875 29.6875 25.912499999999998 21.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 3.0 25 6.0 26 5.5 27 4.5 28 7.0 29 12.5 30 18.0 31 22.0 32 29.0 33 42.0 34 51.5 35 60.0 36 84.5 37 112.0 38 129.5 39 171.5 40 199.5 41 223.5 42 260.0 43 278.0 44 297.5 45 294.5 46 279.0 47 267.0 48 236.5 49 198.0 50 162.5 51 126.5 52 94.0 53 80.0 54 69.0 55 44.0 56 27.5 57 25.5 58 22.0 59 11.5 60 6.5 61 6.5 62 6.0 63 3.0 64 3.0 65 3.0 66 2.0 67 2.0 68 2.0 69 2.0 70 1.5 71 0.5 72 1.0 73 2.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.1625 108-109 0.5 110-111 0.43750000000000006 112-113 0.6625 114-115 0.36250000000000004 116-117 0.08750000000000001 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8489425981873 99.15 2 0.10070493454179255 0.2 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025176233635448138 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 23 0.575 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.0625 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.0875 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.5375 0.0 0.0 0.0 0.0 110-111 3.175 0.0 0.0 0.0 0.0 112-113 3.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATCAT 15 0.0040846216 59.5 40-41 TGAAATT 15 0.0040846216 59.5 102-103 >>END_MODULE Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra Read 1013652 spots for SRR3208061.sra Written 1013652 spots for SRR3208061.sra SRR ids: ['SRR3208061.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3fxg3u4q SRR3208061.sra spots: 20273040 blocks: [[1, 1013652], [1013653, 2027304], [2027305, 3040956], [3040957, 4054608], [4054609, 5068260], [5068261, 6081912], [6081913, 7095564], [7095565, 8109216], [8109217, 9122868], [9122869, 10136520], [10136521, 11150172], [11150173, 12163824], [12163825, 13177476], [13177477, 14191128], [14191129, 15204780], [15204781, 16218432], [16218433, 17232084], [17232085, 18245736], [18245737, 19259388], [19259389, 20273040]] SRR3208061 file size 6492812 SRR3208061 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208061 SRR3208061_1.fastq Input file: SRR3208061_1.fastq trimmed: SRR3208061-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 05:03:06 2025 >> started Wed Feb 12 05:03:17 2025 >> done (11.455s) 20273040 reads processed; of these: 15598 ( 0.08%) short reads filtered out after trimming by size control 208709 ( 1.03%) empty reads filtered out after trimming by size control 20048733 (98.89%) reads available; of these: 1553424 ( 7.75%) trimmed reads available after processing 18495309 (92.25%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 634 0.00% 19 806 0.00% 20 12575 0.06% 21 1036 0.01% 22 765 0.00% 23 1250 0.01% 24 3289 0.02% 25 3451 0.02% 26 1594 0.01% 27 700 0.00% 28 801 0.00% 29 1535 0.01% 30 1369 0.01% 31 1209 0.01% 32 953 0.00% 33 608 0.00% 34 636 0.00% 35 596 0.00% 36 714 0.00% 37 683 0.00% 38 699 0.00% 39 673 0.00% 40 665 0.00% 41 695 0.00% 42 625 0.00% 43 761 0.00% 44 741 0.00% 45 813 0.00% 46 835 0.00% 47 881 0.00% 48 783 0.00% 49 951 0.00% 50 913 0.00% 51 947 0.00% 52 919 0.00% 53 956 0.00% 54 1026 0.01% 55 1100 0.01% 56 1110 0.01% 57 1174 0.01% 58 1324 0.01% 59 1299 0.01% 60 1536 0.01% 61 1620 0.01% 62 2058 0.01% 63 9875 0.05% 64 2291 0.01% 65 1885 0.01% 66 1906 0.01% 67 2086 0.01% 68 2089 0.01% 69 2474 0.01% 70 2614 0.01% 71 3046 0.02% 72 4264 0.02% 73 4347 0.02% 74 4563 0.02% 75 3179 0.02% 76 2854 0.01% 77 3092 0.02% 78 3569 0.02% 79 3865 0.02% 80 4278 0.02% 81 4948 0.02% 82 5429 0.03% 83 6121 0.03% 84 7925 0.04% 85 7094 0.04% 86 7257 0.04% 87 8130 0.04% 88 9516 0.05% 89 11037 0.06% 90 11709 0.06% 91 13309 0.07% 92 15111 0.08% 93 16747 0.08% 94 3348 0.02% 95 3249 0.02% 96 3042 0.02% 97 3086 0.02% 98 3352 0.02% 99 3514 0.02% 100 3818 0.02% 101 4086 0.02% 102 4242 0.02% 103 4562 0.02% 104 4863 0.02% 105 6144 0.03% 106 5924 0.03% 107 6098 0.03% 108 6485 0.03% 109 7434 0.04% 110 8280 0.04% 111 9324 0.05% 112 10280 0.05% 113 11473 0.06% 114 13476 0.07% 115 16254 0.08% 116 18884 0.09% 117 23276 0.12% 118 29382 0.15% 119 36888 0.18% 120 48552 0.24% 121 68559 0.34% 122 105779 0.53% 123 199355 0.99% 124 633497 3.16% 125 18495309 92.25% 20048733 reads passed initial QC criterion=sequence-density sequence-density=3.87 sequence-density-rank=1 fanout-score=47.19 fanout-score-rank=1 prefix-density=5.28 prefix-fanout=34.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAGA criterion=fanout-score sequence-density=3.87 sequence-density-rank=1 fanout-score=47.19 fanout-score-rank=1 prefix-density=5.28 prefix-fanout=34.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAGA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAGA -o SRR3208061 - Input file: STDIN trimmed: SRR3208061-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 05:04:04 2025 >> started Wed Feb 12 05:04:15 2025 >> done (11.658s) 10024367 reads processed; of these: 429 ( 0.00%) short reads filtered out after trimming by size control 11125 ( 0.11%) empty reads filtered out after trimming by size control 10012813 (99.88%) reads available; of these: 1269772 (12.68%) trimmed reads available after processing 8743041 (87.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 323 0.00% 19 425 0.00% 20 9604 0.10% 21 576 0.01% 22 423 0.00% 23 652 0.01% 24 1320 0.01% 25 1349 0.01% 26 1161 0.01% 27 374 0.00% 28 399 0.00% 29 813 0.01% 30 709 0.01% 31 638 0.01% 32 502 0.01% 33 323 0.00% 34 331 0.00% 35 296 0.00% 36 357 0.00% 37 349 0.00% 38 378 0.00% 39 325 0.00% 40 364 0.00% 41 361 0.00% 42 338 0.00% 43 384 0.00% 44 389 0.00% 45 436 0.00% 46 440 0.00% 47 475 0.00% 48 389 0.00% 49 509 0.01% 50 461 0.00% 51 473 0.00% 52 502 0.01% 53 516 0.01% 54 505 0.01% 55 576 0.01% 56 596 0.01% 57 606 0.01% 58 670 0.01% 59 664 0.01% 60 761 0.01% 61 803 0.01% 62 762 0.01% 63 883 0.01% 64 838 0.01% 65 847 0.01% 66 918 0.01% 67 924 0.01% 68 981 0.01% 69 1119 0.01% 70 1122 0.01% 71 1258 0.01% 72 1316 0.01% 73 1388 0.01% 74 1327 0.01% 75 1358 0.01% 76 1394 0.01% 77 1527 0.02% 78 1723 0.02% 79 1883 0.02% 80 2077 0.02% 81 2343 0.02% 82 2572 0.03% 83 2953 0.03% 84 3160 0.03% 85 3295 0.03% 86 3549 0.04% 87 3885 0.04% 88 4311 0.04% 89 4915 0.05% 90 5554 0.06% 91 6240 0.06% 92 7173 0.07% 93 8343 0.08% 94 8931 0.09% 95 10053 0.10% 96 10776 0.11% 97 11538 0.12% 98 12732 0.13% 99 14185 0.14% 100 16250 0.16% 101 18553 0.19% 102 21051 0.21% 103 23996 0.24% 104 26279 0.26% 105 28543 0.29% 106 29756 0.30% 107 31391 0.31% 108 32977 0.33% 109 35953 0.36% 110 40097 0.40% 111 43966 0.44% 112 48679 0.49% 113 53134 0.53% 114 57466 0.57% 115 61755 0.62% 116 64213 0.64% 117 66707 0.67% 118 71124 0.71% 119 78450 0.78% 120 96820 0.97% 121 144657 1.44% 122 316699 3.16% 123 86421 0.86% 124 275169 2.75% 125 8059709 80.49% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=27.58 fanout-score-rank=15 prefix-density=0.17 prefix-fanout=9.7 sequence=TTCTCATCAAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=47 fanout-score=349.39 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=16.5 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGA Started job on | Feb 12 05:04:46 Started mapping on | Feb 12 05:04:47 Finished on | Feb 12 05:05:18 Mapping speed, Million of reads per hour | 2326.90 Number of input reads | 20037179 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 18967036 Uniquely mapped reads % | 94.66% Average mapped length | 122.78 Number of splices: Total | 7145674 Number of splices: Annotated (sjdb) | 7006998 Number of splices: GT/AG | 7035674 Number of splices: GC/AG | 90033 Number of splices: AT/AC | 7107 Number of splices: Non-canonical | 12860 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398527 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 233977 % of reads mapped to too many loci | 1.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 671616 671616 671616 N_multimapping 398527 398527 398527 N_noFeature 777322 9789120 9825096 N_ambiguous 198151 33975 34403 UnstrandedReadsAssigned:17991563 PositiveStrandReadsAssigned:9143941 NegativeStrandReadsAssigned:9107537 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR3208061 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208061-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,037,179 reads, 18,493,678 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR3208061.ke.tsv 34699 SRR3208061.se.tsv 87100 total ==> SRR3208061.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 672 27.0262 Potri.005G024800.1.v4.1 1035 936 147.012 12.1218 Potri.004G059700.1.v4.1 961 862 35 3.13366 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 335.349 9.10037 Potri.016G087400.1.v4.1 270 171 805 363.321 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 74 3.41167 Potri.012G127500.1.v4.1 977 878 3366 295.877 ==> SRR3208061.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1834 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 362 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 37 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR3208061 completed mapping pipeline successfully