Starting /dee2/code/volunteer_pipeline.sh SRR3208062 current disk space = 3049049706496 free memory = 1301974924 SRR3208062 SRAfilesize 964f72e9117ab0902f8eb839e6eab59f SRR3208062.sra SRR3208062.sra file validated SRR3208062 is single end SRR3208062 is conventional basespace SRR3208062 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208062_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.02625 33.0 32.0 34.0 25.0 34.0 2 32.11625 33.0 32.0 34.0 28.0 34.0 3 32.0065 33.0 32.0 34.0 28.0 34.0 4 31.71675 33.0 32.0 34.0 28.0 34.0 5 31.96675 33.0 32.0 34.0 30.0 34.0 6 35.683 38.0 36.0 38.0 30.0 38.0 7 36.1975 38.0 37.0 38.0 33.0 38.0 8 36.25225 38.0 37.0 38.0 33.0 38.0 9 36.35225 38.0 37.0 38.0 33.0 38.0 10-11 36.426625 38.0 37.5 38.0 33.5 38.0 12-13 36.417375 38.0 37.5 38.0 33.5 38.0 14-15 36.4405 38.0 37.5 38.0 34.0 38.0 16-17 36.429500000000004 38.0 38.0 38.0 33.5 38.0 18-19 36.291875000000005 38.0 37.5 38.0 33.5 38.0 20-21 36.396 38.0 37.5 38.0 33.5 38.0 22-23 36.488375 38.0 38.0 38.0 34.0 38.0 24-25 36.415375 38.0 38.0 38.0 34.0 38.0 26-27 36.309 38.0 38.0 38.0 33.5 38.0 28-29 36.372125 38.0 37.5 38.0 33.5 38.0 30-31 36.306375 38.0 38.0 38.0 33.0 38.0 32-33 36.374875 38.0 38.0 38.0 34.0 38.0 34-35 36.331875 38.0 38.0 38.0 33.0 38.0 36-37 36.331375 38.0 37.5 38.0 33.5 38.0 38-39 36.3755 38.0 38.0 38.0 33.5 38.0 40-41 36.388625 38.0 38.0 38.0 34.0 38.0 42-43 36.308 38.0 37.5 38.0 33.5 38.0 44-45 36.286874999999995 38.0 37.5 38.0 33.5 38.0 46-47 36.297875 38.0 37.0 38.0 33.0 38.0 48-49 36.281000000000006 38.0 37.5 38.0 33.0 38.0 50-51 36.425875 38.0 38.0 38.0 34.0 38.0 52-53 36.34925 38.0 38.0 38.0 34.0 38.0 54-55 36.326499999999996 38.0 38.0 38.0 33.5 38.0 56-57 36.312250000000006 38.0 38.0 38.0 33.5 38.0 58-59 36.316375 38.0 37.5 38.0 33.0 38.0 60-61 36.257625 38.0 37.0 38.0 33.0 38.0 62-63 36.196 38.0 37.0 38.0 33.0 38.0 64-65 36.248000000000005 38.0 37.5 38.0 33.0 38.0 66-67 36.380875 38.0 38.0 38.0 33.5 38.0 68-69 36.435874999999996 38.0 38.0 38.0 34.0 38.0 70-71 36.359375 38.0 38.0 38.0 33.5 38.0 72-73 36.308625 38.0 38.0 38.0 34.0 38.0 74-75 36.29425 38.0 38.0 38.0 33.5 38.0 76-77 36.099125 38.0 37.0 38.0 33.0 38.0 78-79 36.2145 38.0 37.5 38.0 33.5 38.0 80-81 36.274 38.0 37.5 38.0 33.5 38.0 82-83 36.218125 38.0 37.5 38.0 33.0 38.0 84-85 36.2295 38.0 37.0 38.0 33.0 38.0 86-87 36.16275 38.0 37.0 38.0 33.0 38.0 88-89 36.1285 38.0 37.0 38.0 33.0 38.0 90-91 36.08625 38.0 37.0 38.0 33.0 38.0 92-93 36.078 38.0 37.0 38.0 33.0 38.0 94-95 36.064125000000004 38.0 37.0 38.0 33.0 38.0 96-97 36.016625000000005 38.0 37.0 38.0 32.0 38.0 98-99 36.121375 38.0 37.0 38.0 33.0 38.0 100-101 35.883125 38.0 37.0 38.0 31.0 38.0 102-103 36.017125 38.0 37.0 38.0 33.0 38.0 104-105 36.070875 38.0 37.0 38.0 33.0 38.0 106-107 35.66674999999999 38.0 37.0 38.0 30.5 38.0 108-109 35.119625 38.0 37.0 38.0 29.0 38.0 110-111 35.05375 38.0 37.0 38.0 28.5 38.0 112-113 34.878874999999994 38.0 37.0 38.0 27.5 38.0 114-115 35.037625 38.0 36.5 38.0 27.5 38.0 116-117 35.307 38.0 36.5 38.0 28.5 38.0 118-119 35.545375 38.0 37.0 38.0 31.0 38.0 120-121 35.395250000000004 38.0 36.5 38.0 30.0 38.0 122-123 35.284875 38.0 37.0 38.0 31.0 38.0 124-125 33.757875 37.5 34.0 38.0 23.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 3.0 21 1.0 22 2.0 23 7.0 24 12.0 25 13.0 26 23.0 27 28.0 28 43.0 29 49.0 30 82.0 31 106.0 32 145.0 33 180.0 34 249.0 35 319.0 36 514.0 37 2215.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.584822584822582 14.78891478891479 12.924112924112924 49.7021497021497 2 18.7 20.775 40.575 19.950000000000003 3 20.549999999999997 25.0 28.849999999999998 25.6 4 24.85 29.4 21.7 24.05 5 24.375 34.125 22.900000000000002 18.6 6 18.15 37.8 24.4 19.650000000000002 7 16.925 19.075 42.925000000000004 21.075 8 17.5 24.05 31.7 26.75 9 18.975 23.599999999999998 32.875 24.55 10-11 21.837500000000002 33.7375 23.549999999999997 20.875 12-13 20.3875 26.687499999999996 29.9375 22.9875 14-15 21.2 27.187499999999996 29.65 21.9625 16-17 22.15 28.0875 27.487499999999997 22.275 18-19 21.224999999999998 28.5875 28.475 21.712500000000002 20-21 21.15 29.1125 28.025 21.712500000000002 22-23 21.2375 29.1375 28.025 21.6 24-25 21.349999999999998 28.075 28.3375 22.237499999999997 26-27 21.25 28.5625 28.075 22.112499999999997 28-29 21.6625 29.012500000000003 27.437499999999996 21.8875 30-31 20.9875 28.475 29.025000000000002 21.512500000000003 32-33 20.150000000000002 28.5875 29.575000000000003 21.6875 34-35 22.112499999999997 28.6625 27.35 21.875 36-37 20.0875 29.6875 28.0625 22.162499999999998 38-39 20.962500000000002 28.9375 27.525 22.575 40-41 21.5 28.787499999999998 28.962500000000002 20.75 42-43 21.349999999999998 28.5625 28.6625 21.425 44-45 22.037499999999998 28.175 27.775 22.0125 46-47 22.025 28.1625 27.425 22.3875 48-49 22.025 27.700000000000003 28.6125 21.6625 50-51 21.6125 27.712500000000002 28.4 22.275 52-53 20.8875 28.849999999999998 28.262500000000003 22.0 54-55 21.587500000000002 28.762500000000003 27.925 21.725 56-57 21.212500000000002 28.712500000000002 28.449999999999996 21.625 58-59 20.6375 28.775000000000002 28.3125 22.275 60-61 22.575 26.887499999999996 27.6875 22.85 62-63 21.087500000000002 28.749999999999996 28.975 21.1875 64-65 22.15 27.537499999999998 28.5625 21.75 66-67 21.1125 27.925 29.65 21.3125 68-69 21.125 28.6125 28.075 22.1875 70-71 21.224999999999998 27.962500000000002 28.8875 21.925 72-73 21.125 27.8625 28.762500000000003 22.25 74-75 21.5625 28.325 28.075 22.037499999999998 76-77 22.275 28.375 27.9125 21.4375 78-79 21.5375 27.8125 28.999999999999996 21.65 80-81 21.85 27.525 28.599999999999998 22.025 82-83 21.2375 28.849999999999998 28.5625 21.349999999999998 84-85 22.875 27.6875 28.249999999999996 21.1875 86-87 21.3625 28.4375 28.549999999999997 21.65 88-89 20.9 28.212500000000002 29.4 21.4875 90-91 21.15 28.025 28.4375 22.3875 92-93 22.3 28.037499999999998 28.3625 21.3 94-95 21.475 28.575 28.4125 21.5375 96-97 22.2 28.599999999999998 28.512500000000003 20.6875 98-99 21.8125 28.3875 28.849999999999998 20.95 100-101 21.45 28.575 28.425 21.55 102-103 21.6625 28.0875 28.4125 21.837500000000002 104-105 22.650000000000002 28.749999999999996 27.900000000000002 20.7 106-107 22.740451279465525 28.728097819236105 27.454935081305937 21.076515819992437 108-109 22.416004103616313 28.71249038214927 27.77635291100282 21.095152603231597 110-111 22.718570516911296 28.56413529036375 26.917677089980856 21.799617102744097 112-113 22.097812097812096 29.150579150579148 27.670527670527672 21.08108108108108 114-115 21.942537503178237 29.010933129926265 27.43452834986016 21.612001017035343 116-117 22.90699133927451 29.71005397263713 26.99887034015313 20.384084347935232 118-119 22.900000000000002 28.6125 27.575 20.9125 120-121 22.6875 27.375 27.500000000000004 22.4375 122-123 22.625 29.625 26.8625 20.8875 124-125 22.475 29.1375 27.537499999999998 20.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 2.5 25 3.5 26 5.0 27 7.5 28 10.5 29 17.0 30 24.0 31 27.5 32 39.5 33 54.0 34 60.0 35 75.0 36 100.5 37 125.5 38 153.5 39 182.0 40 207.5 41 233.5 42 251.0 43 257.5 44 268.0 45 281.5 46 262.5 47 236.0 48 224.5 49 190.0 50 159.5 51 136.5 52 111.5 53 82.0 54 47.5 55 36.5 56 31.5 57 21.5 58 17.0 59 11.5 60 8.5 61 6.5 62 4.5 63 3.5 64 2.5 65 2.0 66 1.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.8375 108-109 2.5250000000000004 110-111 2.0625 112-113 2.875 114-115 1.675 116-117 0.41250000000000003 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.425 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 2.1500000000000004 0.0 0.0 0.0 0.0 108-109 2.5875 0.0 0.0 0.0 0.0 110-111 3.2 0.0 0.0 0.0 0.0 112-113 3.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352784 spots for SRR3208062.sra Written 1352784 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra Read 1352765 spots for SRR3208062.sra Written 1352765 spots for SRR3208062.sra SRR ids: ['SRR3208062.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g45bcn2n SRR3208062.sra spots: 27055319 blocks: [[1, 1352765], [1352766, 2705530], [2705531, 4058295], [4058296, 5411060], [5411061, 6763825], [6763826, 8116590], [8116591, 9469355], [9469356, 10822120], [10822121, 12174885], [12174886, 13527650], [13527651, 14880415], [14880416, 16233180], [16233181, 17585945], [17585946, 18938710], [18938711, 20291475], [20291476, 21644240], [21644241, 22997005], [22997006, 24349770], [24349771, 25702535], [25702536, 27055319]] SRR3208062 file size 8668646 SRR3208062 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208062 SRR3208062_1.fastq Input file: SRR3208062_1.fastq trimmed: SRR3208062-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:55:26 2025 >> started Wed Feb 12 04:55:47 2025 >> done (20.605s) 27055319 reads processed; of these: 8279 ( 0.03%) short reads filtered out after trimming by size control 48359 ( 0.18%) empty reads filtered out after trimming by size control 26998681 (99.79%) reads available; of these: 2092314 ( 7.75%) trimmed reads available after processing 24906367 (92.25%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 355 0.00% 19 326 0.00% 20 359 0.00% 21 464 0.00% 22 454 0.00% 23 635 0.00% 24 3710 0.01% 25 4027 0.01% 26 790 0.00% 27 593 0.00% 28 568 0.00% 29 744 0.00% 30 1169 0.00% 31 949 0.00% 32 962 0.00% 33 447 0.00% 34 485 0.00% 35 508 0.00% 36 534 0.00% 37 567 0.00% 38 520 0.00% 39 529 0.00% 40 562 0.00% 41 576 0.00% 42 609 0.00% 43 647 0.00% 44 701 0.00% 45 712 0.00% 46 648 0.00% 47 712 0.00% 48 741 0.00% 49 797 0.00% 50 865 0.00% 51 849 0.00% 52 843 0.00% 53 892 0.00% 54 1015 0.00% 55 1014 0.00% 56 1038 0.00% 57 1037 0.00% 58 1105 0.00% 59 1202 0.00% 60 1257 0.00% 61 1332 0.00% 62 1382 0.01% 63 1561 0.01% 64 1477 0.01% 65 1460 0.01% 66 1594 0.01% 67 1737 0.01% 68 1772 0.01% 69 2008 0.01% 70 2091 0.01% 71 2277 0.01% 72 2523 0.01% 73 2883 0.01% 74 2972 0.01% 75 2876 0.01% 76 3069 0.01% 77 3261 0.01% 78 3683 0.01% 79 3923 0.01% 80 4357 0.02% 81 4813 0.02% 82 5445 0.02% 83 6067 0.02% 84 6556 0.02% 85 7036 0.03% 86 7437 0.03% 87 8196 0.03% 88 9088 0.03% 89 10130 0.04% 90 11651 0.04% 91 13882 0.05% 92 15715 0.06% 93 17566 0.07% 94 3563 0.01% 95 3483 0.01% 96 3715 0.01% 97 3964 0.01% 98 4170 0.02% 99 4329 0.02% 100 4762 0.02% 101 5050 0.02% 102 5639 0.02% 103 6108 0.02% 104 6533 0.02% 105 8175 0.03% 106 7750 0.03% 107 8377 0.03% 108 8697 0.03% 109 10119 0.04% 110 11360 0.04% 111 12747 0.05% 112 14378 0.05% 113 16364 0.06% 114 18768 0.07% 115 23146 0.09% 116 26873 0.10% 117 34022 0.13% 118 43155 0.16% 119 54398 0.20% 120 71332 0.26% 121 101748 0.38% 122 157594 0.58% 123 296953 1.10% 124 905705 3.35% 125 24906367 92.25% 26998681 reads passed initial QC criterion=sequence-density sequence-density=3.30 sequence-density-rank=1 fanout-score=49.20 fanout-score-rank=1 prefix-density=4.60 prefix-fanout=35.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC criterion=fanout-score sequence-density=3.30 sequence-density-rank=1 fanout-score=49.20 fanout-score-rank=1 prefix-density=4.60 prefix-fanout=35.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC -o SRR3208062 - Input file: STDIN trimmed: SRR3208062-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:56:49 2025 >> started Wed Feb 12 04:57:03 2025 >> done (13.722s) 13499341 reads processed; of these: 98 ( 0.00%) short reads filtered out after trimming by size control 699 ( 0.01%) empty reads filtered out after trimming by size control 13498544 (99.99%) reads available; of these: 1585632 (11.75%) trimmed reads available after processing 11912912 (88.25%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 185 0.00% 19 160 0.00% 20 206 0.00% 21 255 0.00% 22 283 0.00% 23 338 0.00% 24 2059 0.02% 25 2029 0.02% 26 421 0.00% 27 319 0.00% 28 301 0.00% 29 370 0.00% 30 567 0.00% 31 495 0.00% 32 473 0.00% 33 227 0.00% 34 255 0.00% 35 248 0.00% 36 273 0.00% 37 304 0.00% 38 266 0.00% 39 256 0.00% 40 257 0.00% 41 280 0.00% 42 287 0.00% 43 330 0.00% 44 346 0.00% 45 363 0.00% 46 328 0.00% 47 376 0.00% 48 373 0.00% 49 405 0.00% 50 446 0.00% 51 425 0.00% 52 442 0.00% 53 448 0.00% 54 504 0.00% 55 496 0.00% 56 537 0.00% 57 517 0.00% 58 541 0.00% 59 583 0.00% 60 634 0.00% 61 697 0.01% 62 684 0.01% 63 767 0.01% 64 749 0.01% 65 741 0.01% 66 807 0.01% 67 876 0.01% 68 890 0.01% 69 961 0.01% 70 1015 0.01% 71 1105 0.01% 72 1217 0.01% 73 1271 0.01% 74 1296 0.01% 75 1385 0.01% 76 1564 0.01% 77 1654 0.01% 78 1804 0.01% 79 1991 0.01% 80 2166 0.02% 81 2453 0.02% 82 2788 0.02% 83 3032 0.02% 84 3308 0.02% 85 3570 0.03% 86 3769 0.03% 87 4059 0.03% 88 4609 0.03% 89 5075 0.04% 90 5853 0.04% 91 6876 0.05% 92 7795 0.06% 93 8871 0.07% 94 9949 0.07% 95 10923 0.08% 96 11900 0.09% 97 13215 0.10% 98 14468 0.11% 99 16162 0.12% 100 18692 0.14% 101 21610 0.16% 102 24461 0.18% 103 27828 0.21% 104 30928 0.23% 105 33557 0.25% 106 35581 0.26% 107 37539 0.28% 108 40044 0.30% 109 44200 0.33% 110 48931 0.36% 111 54095 0.40% 112 60750 0.45% 113 66995 0.50% 114 72577 0.54% 115 77749 0.58% 116 81737 0.61% 117 86162 0.64% 118 93099 0.69% 119 103362 0.77% 120 129150 0.96% 121 196784 1.46% 122 432089 3.20% 123 129752 0.96% 124 397590 2.95% 125 10971759 81.28% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=90.90 fanout-score-rank=10 prefix-density=0.29 prefix-fanout=18.2 sequence=TTCTTTCTTTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=456.26 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=17.1 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGAAACTTGCACAATGCACCTACGAGCAAGACCATTTGCTACGATGCTCTTGGCAGC Started job on | Feb 12 04:57:32 Started mapping on | Feb 12 04:57:32 Finished on | Feb 12 04:58:15 Mapping speed, Million of reads per hour | 2260.29 Number of input reads | 26997884 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 25432595 Uniquely mapped reads % | 94.20% Average mapped length | 123.01 Number of splices: Total | 9631961 Number of splices: Annotated (sjdb) | 9448143 Number of splices: GT/AG | 9484224 Number of splices: GC/AG | 121111 Number of splices: AT/AC | 9619 Number of splices: Non-canonical | 17007 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 517191 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 326223 % of reads mapped to too many loci | 1.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1048098 1048098 1048098 N_multimapping 517191 517191 517191 N_noFeature 1056805 13136855 13184583 N_ambiguous 259153 45448 46213 UnstrandedReadsAssigned:24116637 PositiveStrandReadsAssigned:12250292 NegativeStrandReadsAssigned:12201799 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR3208062 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208062-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,997,884 reads, 24,807,936 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR3208062.ke.tsv 34699 SRR3208062.se.tsv 87100 total ==> SRR3208062.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 920 27.6562 Potri.005G024800.1.v4.1 1035 936 214 13.1892 Potri.004G059700.1.v4.1 961 862 50 3.34613 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 446.52 9.05714 Potri.016G087400.1.v4.1 270 171 1181 398.413 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 104.552 3.60294 Potri.012G127500.1.v4.1 977 878 5045 331.472 ==> SRR3208062.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 2740 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 432 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR3208062 completed mapping pipeline successfully