Starting /dee2/code/volunteer_pipeline.sh SRR3241527 current disk space = 3059178926080 free memory = 1413908356 SRR3241527 SRAfilesize b72a076e57d7efb209d07ea557f3967d SRR3241527.sra SRR3241527.sra file validated SRR3241527 is single end SRR3241527 is conventional basespace SRR3241527 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241527_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09175 34.0 33.0 34.0 31.0 34.0 2 33.19975 34.0 34.0 34.0 31.0 34.0 3 33.29 34.0 34.0 34.0 31.0 34.0 4 36.5835 37.0 37.0 37.0 35.0 37.0 5 36.535 37.0 37.0 37.0 35.0 37.0 6 36.516 37.0 37.0 37.0 35.0 37.0 7 36.535 37.0 37.0 37.0 35.0 37.0 8 36.4885 37.0 37.0 37.0 35.0 37.0 9 38.36975 39.0 39.0 39.0 37.0 39.0 10-11 38.351875 39.0 39.0 39.0 37.0 39.0 12-13 38.25425 39.0 39.0 39.0 37.0 39.0 14-15 39.904875000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.880375 41.0 40.0 41.0 38.0 41.0 18-19 39.838625 41.0 40.0 41.0 38.0 41.0 20-21 39.826499999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.7325 41.0 40.0 41.0 37.5 41.0 24-25 39.760375 41.0 40.0 41.0 37.5 41.0 26-27 39.618875 41.0 40.0 41.0 37.0 41.0 28-29 39.523125 41.0 40.0 41.0 37.0 41.0 30-31 39.508250000000004 41.0 39.5 41.0 37.0 41.0 32-33 39.297375 41.0 39.0 41.0 36.5 41.0 34-35 39.2855 40.0 39.0 41.0 36.0 41.0 36-37 39.503625 41.0 39.5 41.0 37.0 41.0 38-39 39.2965 41.0 39.5 41.0 36.0 41.0 40-41 39.4145 41.0 40.0 41.0 37.0 41.0 42-43 39.558125000000004 41.0 40.0 41.0 37.0 41.0 44-45 39.282250000000005 41.0 39.0 41.0 36.0 41.0 46-47 39.369875 41.0 39.5 41.0 36.0 41.0 48-49 39.296 41.0 39.0 41.0 35.5 41.0 50-51 39.16825 41.0 39.0 41.0 35.0 41.0 52-53 38.962375 41.0 39.0 41.0 35.0 41.0 54-55 38.524874999999994 40.0 38.0 41.0 34.0 41.0 56-57 38.522625000000005 40.0 38.0 41.0 34.5 41.0 58-59 38.477125 40.0 38.0 41.0 34.0 41.0 60-61 38.308499999999995 40.0 37.0 41.0 34.0 41.0 62-63 38.147000000000006 40.0 37.0 41.0 34.0 41.0 64-65 37.94025 39.0 36.5 41.0 34.0 41.0 66-67 37.599125 39.0 36.0 41.0 34.0 41.0 68-69 37.25775 38.5 35.5 40.5 34.0 41.0 70-71 36.874625 37.5 35.0 40.0 34.0 41.0 72-73 36.501000000000005 37.0 35.0 39.0 33.0 41.0 74-75 35.998374999999996 36.5 35.0 39.0 33.0 40.5 76-77 34.509 35.0 33.5 37.0 30.5 39.0 78-79 35.076875 35.5 35.0 37.0 32.0 39.0 80-81 34.891875 35.0 35.0 37.0 32.0 39.0 82-83 34.573499999999996 35.0 35.0 36.0 32.0 37.0 84-85 34.252250000000004 35.0 34.5 36.0 32.0 37.0 86-87 34.132374999999996 35.0 35.0 36.0 32.0 36.5 88-89 33.917874999999995 35.0 34.0 35.0 32.0 36.0 90-91 33.68275 35.0 34.0 35.0 31.0 36.0 92-93 33.513625000000005 35.0 34.0 35.0 31.0 36.0 94-95 33.439625 35.0 34.0 35.0 31.0 36.0 96-97 33.1045 35.0 34.0 35.0 30.5 35.0 98-99 32.977375 35.0 34.0 35.0 30.5 35.0 100 32.8765 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.005675067620515506 1101 2 0.052225789327330574 1101 3 -0.03849945650799924 1101 4 -0.06437220354407458 1101 5 -0.0709320255820387 1101 6 -0.13185368689805443 1101 7 -0.08261078389241305 1101 8 -0.12492732374428073 1101 9 0.048813165145730864 1101 10-11 -0.03668570995222353 1101 12-13 -0.12773957885689669 1101 14-15 -0.05463358527769202 1101 16-17 0.1149864758967638 1101 18-19 0.15689855658636276 1101 20-21 -0.060314972572612646 1101 22-23 -0.08231375919513084 1101 24-25 -0.1102972774842641 1101 26-27 -0.14563057711266225 1101 28-29 -0.012683586541619718 1101 30-31 0.1131221719456974 1101 32-33 -0.153100432265731 1101 34-35 -0.07649965873758191 1101 36-37 -7.267625571927283E-4 1101 38-39 -0.24437548977476808 1101 40-41 0.027022927778759254 1101 42-43 0.14155438711797075 1101 44-45 0.2988763618898318 1101 46-47 0.041798326550214426 1101 48-49 0.12325261002553844 1101 50-51 0.0731691903233127 1101 52-53 0.09704492024571465 1101 54-55 -0.05031724765539991 1101 56-57 -0.12663995550948925 1101 58-59 0.015255694026642175 1101 60-61 0.021423696251169133 1101 62-63 0.010383225056244783 1101 64-65 0.03223665916731733 1101 66-67 0.06171162061730229 1101 68-69 0.18550140296771644 1101 70-71 -0.04183624459668067 1101 72-73 0.1715033241487447 1101 74-75 0.003576935716267826 1101 76-77 0.1878586415227943 1101 78-79 -0.016721858489844976 1101 80-81 0.23474430597335783 1101 82-83 0.3045956672312258 1101 84-85 0.13981647665512753 1101 86-87 0.04982431305138846 1101 88-89 0.12282919184004015 1101 90-91 0.07764983948026583 1101 92-93 -0.08110038170833889 1101 94-95 0.09324679592507579 1101 96-97 -0.044503147197858084 1101 98-99 -0.07171566520892725 1101 100 0.016342678025225155 1107 1 0.005675067620515506 1107 2 -0.05222578932733768 1107 3 0.03849945650800635 1107 4 0.06437220354407458 1107 5 0.07093202558204581 1107 6 0.13185368689804733 1107 7 0.08261078389241305 1107 8 0.12492732374428073 1107 9 -0.048813165145730864 1107 10-11 0.03668570995222353 1107 12-13 0.12773957885689669 1107 14-15 0.05463358527769202 1107 16-17 -0.1149864758967567 1107 18-19 -0.15689855658636276 1107 20-21 0.060314972572612646 1107 22-23 0.08231375919512374 1107 24-25 0.1102972774842641 1107 26-27 0.14563057711266936 1107 28-29 0.012683586541619718 1107 30-31 -0.11312217194570451 1107 32-33 0.153100432265731 1107 34-35 0.07649965873758191 1107 36-37 7.267625571927283E-4 1107 38-39 0.24437548977476808 1107 40-41 -0.027022927778759254 1107 42-43 -0.14155438711797785 1107 44-45 -0.2988763618898389 1107 46-47 -0.041798326550214426 1107 48-49 -0.12325261002553134 1107 50-51 -0.0731691903233127 1107 52-53 -0.09704492024570754 1107 54-55 0.050317247655407016 1107 56-57 0.12663995550948925 1107 58-59 -0.01525569402664928 1107 60-61 -0.021423696251169133 1107 62-63 -0.010383225056244783 1107 64-65 -0.03223665916731733 1107 66-67 -0.06171162061730229 1107 68-69 -0.18550140296771644 1107 70-71 0.04183624459668067 1107 72-73 -0.1715033241487376 1107 74-75 -0.0035769357162749316 1107 76-77 -0.1878586415227872 1107 78-79 0.01672185848985208 1107 80-81 -0.23474430597335783 1107 82-83 -0.3045956672312258 1107 84-85 -0.13981647665512043 1107 86-87 -0.04982431305139556 1107 88-89 -0.12282919184004015 1107 90-91 -0.07764983948027293 1107 92-93 0.08110038170833889 1107 94-95 -0.09324679592507579 1107 96-97 0.044503147197858084 1107 98-99 0.07171566520892725 1107 100 -0.016342678025225155 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 2.0 18 1.0 19 3.0 20 3.0 21 4.0 22 5.0 23 9.0 24 12.0 25 11.0 26 11.0 27 23.0 28 28.0 29 30.0 30 29.0 31 44.0 32 51.0 33 80.0 34 94.0 35 155.0 36 301.0 37 809.0 38 1806.0 39 488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.55889724310777 15.388471177944862 19.072681704260653 41.97994987468672 2 20.925 22.325 36.575 20.175 3 23.1 26.8 26.25 23.849999999999998 4 23.875 31.900000000000002 21.4 22.825 5 25.624999999999996 33.35 23.175 17.849999999999998 6 18.5 37.85 24.099999999999998 19.55 7 16.05 18.55 45.275 20.125 8 20.0 23.599999999999998 29.675 26.724999999999998 9 20.4 23.599999999999998 31.2 24.8 10-11 22.55 34.4375 22.6125 20.4 12-13 19.537499999999998 27.187499999999996 30.612499999999997 22.662499999999998 14-15 21.075 28.175 29.099999999999998 21.65 16-17 21.65 28.262500000000003 27.750000000000004 22.3375 18-19 21.7 29.3875 27.250000000000004 21.6625 20-21 22.075 28.7375 27.9375 21.25 22-23 21.25 28.812500000000004 28.3125 21.625 24-25 22.0 28.725 27.250000000000004 22.025 26-27 22.7 28.275 27.287499999999998 21.7375 28-29 20.962500000000002 28.4375 28.9125 21.6875 30-31 21.45 28.9125 27.3125 22.325 32-33 21.4875 28.9875 27.6125 21.912499999999998 34-35 20.275000000000002 28.962500000000002 28.549999999999997 22.2125 36-37 20.9125 28.225 27.6875 23.175 38-39 22.3875 28.3875 27.8875 21.337500000000002 40-41 22.400000000000002 28.025 27.8125 21.762500000000003 42-43 22.35 27.725 27.975 21.95 44-45 21.8 28.1875 28.3125 21.7 46-47 21.275 29.1875 27.8375 21.7 48-49 21.912499999999998 27.6125 28.849999999999998 21.625 50-51 20.424999999999997 29.4125 28.3875 21.775 52-53 21.05 28.6125 28.4125 21.925 54-55 21.55 29.275000000000002 27.6875 21.4875 56-57 22.662499999999998 28.712500000000002 27.400000000000002 21.224999999999998 58-59 22.25 29.2375 27.6125 20.9 60-61 21.8125 28.725 27.462500000000002 22.0 62-63 21.8 28.925 27.725 21.55 64-65 21.762500000000003 28.675 28.275 21.2875 66-67 21.4 29.425 28.0875 21.087500000000002 68-69 22.2 28.3625 27.712500000000002 21.725 70-71 22.675 27.675 28.237499999999997 21.4125 72-73 21.7875 28.5875 27.525 22.1 74-75 22.1375 28.499999999999996 28.349999999999998 21.0125 76-77 21.987499999999997 27.825 28.4 21.7875 78-79 21.3625 28.1875 27.712500000000002 22.7375 80-81 21.3875 28.537499999999998 28.475 21.6 82-83 22.025 28.725 27.85 21.4 84-85 21.375 28.675 28.5625 21.3875 86-87 21.575 29.2 27.9375 21.2875 88-89 21.224999999999998 28.349999999999998 28.1125 22.3125 90-91 21.675 28.6375 27.8125 21.875 92-93 21.337500000000002 28.287499999999998 28.6375 21.7375 94-95 20.7375 28.962500000000002 28.075 22.225 96-97 20.974999999999998 29.225 28.037499999999998 21.762500000000003 98-99 21.912499999999998 28.5875 27.6875 21.8125 100 22.7 28.975 26.974999999999998 21.349999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 1.5 24 1.5 25 5.0 26 8.5 27 15.5 28 16.0 29 15.0 30 20.5 31 32.5 32 44.5 33 53.0 34 72.0 35 87.0 36 108.0 37 130.0 38 140.0 39 169.0 40 219.0 41 249.5 42 239.5 43 240.0 44 265.0 45 254.5 46 236.5 47 232.0 48 218.0 49 192.5 50 152.5 51 119.5 52 96.5 53 73.0 54 62.5 55 48.5 56 29.5 57 23.0 58 22.5 59 18.0 60 14.0 61 14.0 62 11.0 63 9.0 64 6.5 65 8.0 66 6.0 67 2.5 68 3.0 69 3.5 70 2.0 71 1.0 72 2.0 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488838 spots for SRR3241527.sra Written 488838 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra Read 488820 spots for SRR3241527.sra Written 488820 spots for SRR3241527.sra SRR ids: ['SRR3241527.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bblnshsk SRR3241527.sra spots: 9776418 blocks: [[1, 488820], [488821, 977640], [977641, 1466460], [1466461, 1955280], [1955281, 2444100], [2444101, 2932920], [2932921, 3421740], [3421741, 3910560], [3910561, 4399380], [4399381, 4888200], [4888201, 5377020], [5377021, 5865840], [5865841, 6354660], [6354661, 6843480], [6843481, 7332300], [7332301, 7821120], [7821121, 8309940], [8309941, 8798760], [8798761, 9287580], [9287581, 9776418]] SRR3241527 file size 2543128 SRR3241527 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241527 SRR3241527_1.fastq Input file: SRR3241527_1.fastq trimmed: SRR3241527-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:11:04 2025 >> started Mon Feb 10 15:11:12 2025 >> done (8.380s) 9776418 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 9776418 (100.00%) reads available; of these: 406212 ( 4.16%) trimmed reads available after processing 9370206 (95.84%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1036 0.01% 52 1274 0.01% 53 1667 0.02% 54 1970 0.02% 55 2127 0.02% 56 2512 0.03% 57 2465 0.03% 58 2764 0.03% 59 2749 0.03% 60 2985 0.03% 61 3014 0.03% 62 3204 0.03% 63 3278 0.03% 64 3324 0.03% 65 3381 0.03% 66 3436 0.04% 67 3746 0.04% 68 3849 0.04% 69 3851 0.04% 70 4165 0.04% 71 4166 0.04% 72 4434 0.05% 73 4715 0.05% 74 4840 0.05% 75 5202 0.05% 76 3150 0.03% 77 3560 0.04% 78 4137 0.04% 79 4476 0.05% 80 4898 0.05% 81 5259 0.05% 82 5575 0.06% 83 5918 0.06% 84 6274 0.06% 85 6933 0.07% 86 7502 0.08% 87 7976 0.08% 88 8559 0.09% 89 9348 0.10% 90 10412 0.11% 91 11790 0.12% 92 13122 0.13% 93 15670 0.16% 94 18829 0.19% 95 21590 0.22% 96 26103 0.27% 97 34930 0.36% 98 46770 0.48% 99 43276 0.44% 100 9370206 95.84% 9776418 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=28.27 fanout-score-rank=13 prefix-density=0.20 prefix-fanout=7.6 sequence=AGAAAAGAAAAGAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=215.46 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=22.4 sequence=CTTCTTCTTCTT Started job on | Feb 10 15:11:36 Started mapping on | Feb 10 15:11:36 Finished on | Feb 10 15:11:51 Mapping speed, Million of reads per hour | 2346.34 Number of input reads | 9776418 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 9197033 Uniquely mapped reads % | 94.07% Average mapped length | 99.23 Number of splices: Total | 2382949 Number of splices: Annotated (sjdb) | 2325924 Number of splices: GT/AG | 2340195 Number of splices: GC/AG | 35240 Number of splices: AT/AC | 2500 Number of splices: Non-canonical | 5014 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.10 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254935 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 262229 % of reads mapped to too many loci | 2.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.63% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 324450 324450 324450 N_multimapping 254935 254935 254935 N_noFeature 573228 4840434 4876766 N_ambiguous 89274 18140 18308 UnstrandedReadsAssigned:8534531 PositiveStrandReadsAssigned:4338459 NegativeStrandReadsAssigned:4301959 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241527 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241527-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,776,418 reads, 8,944,477 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52401 SRR3241527.ke.tsv 34699 SRR3241527.se.tsv 87100 total ==> SRR3241527.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 554 44.5986 Potri.005G024800.1.v4.1 1035 936 295 48.6892 Potri.004G059700.1.v4.1 961 862 9 1.61295 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 216.157 11.7416 Potri.016G087400.1.v4.1 270 171 200.412 181.057 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 56 5.16796 Potri.012G127500.1.v4.1 977 878 1595 280.642 ==> SRR3241527.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 942 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 32 SRR3241527 completed mapping pipeline successfully