Starting /dee2/code/volunteer_pipeline.sh SRR3241528 current disk space = 3058772164608 free memory = 1410698948 SRR3241528 SRAfilesize 896d1fb6d38ab826d79496ae2a9fee6a SRR3241528.sra SRR3241528.sra file validated SRR3241528 is single end SRR3241528 is conventional basespace SRR3241528 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241528_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03925 34.0 33.0 34.0 31.0 34.0 2 33.2255 34.0 34.0 34.0 31.0 34.0 3 33.3385 34.0 34.0 34.0 31.0 34.0 4 36.5585 37.0 37.0 37.0 35.0 37.0 5 36.59 37.0 37.0 37.0 35.0 37.0 6 36.53425 37.0 37.0 37.0 35.0 37.0 7 36.5645 37.0 37.0 37.0 35.0 37.0 8 36.5655 37.0 37.0 37.0 35.0 37.0 9 38.4425 39.0 39.0 39.0 37.0 39.0 10-11 38.4255 39.0 39.0 39.0 37.0 39.0 12-13 38.373125 39.0 39.0 39.0 37.0 39.0 14-15 39.9395 41.0 40.0 41.0 38.0 41.0 16-17 39.896249999999995 41.0 40.0 41.0 38.0 41.0 18-19 39.982625 41.0 40.0 41.0 38.0 41.0 20-21 39.910624999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.903999999999996 41.0 40.0 41.0 38.0 41.0 24-25 39.822625 41.0 40.0 41.0 38.0 41.0 26-27 39.71425 41.0 40.0 41.0 37.5 41.0 28-29 39.7205 41.0 40.0 41.0 38.0 41.0 30-31 39.6905 41.0 40.0 41.0 38.0 41.0 32-33 39.44 41.0 40.0 41.0 37.0 41.0 34-35 39.40175 41.0 39.0 41.0 37.0 41.0 36-37 39.600875 41.0 40.0 41.0 37.5 41.0 38-39 39.5 41.0 40.0 41.0 37.0 41.0 40-41 39.650875 41.0 40.0 41.0 37.0 41.0 42-43 39.737375 41.0 40.0 41.0 38.0 41.0 44-45 39.598125 41.0 40.0 41.0 37.0 41.0 46-47 39.55 41.0 40.0 41.0 37.0 41.0 48-49 39.536375 41.0 40.0 41.0 37.0 41.0 50-51 39.461375000000004 41.0 39.0 41.0 36.0 41.0 52-53 39.28125 41.0 39.0 41.0 35.5 41.0 54-55 38.911125 40.0 39.0 41.0 35.0 41.0 56-57 38.749750000000006 40.0 38.0 41.0 35.0 41.0 58-59 38.89575 40.0 38.0 41.0 35.0 41.0 60-61 38.742000000000004 40.0 38.0 41.0 35.0 41.0 62-63 38.383375 40.0 37.0 41.0 35.0 41.0 64-65 38.19675 39.5 37.0 41.0 35.0 41.0 66-67 37.794125 39.0 36.0 41.0 34.0 41.0 68-69 37.540625000000006 39.0 36.0 40.5 34.0 41.0 70-71 37.081625 37.5 35.5 40.0 34.0 41.0 72-73 36.646375 37.0 35.0 39.0 33.5 41.0 74-75 36.218500000000006 37.0 35.0 39.0 33.0 40.5 76-77 34.816125 35.0 34.0 37.0 31.0 39.0 78-79 35.22525 35.5 35.0 37.0 32.5 39.0 80-81 34.916375 35.0 35.0 37.0 32.5 39.0 82-83 34.63225 35.0 35.0 36.0 32.5 37.0 84-85 34.404125 35.0 35.0 36.0 32.5 37.0 86-87 34.21875 35.0 35.0 36.0 32.0 37.0 88-89 34.028875 35.0 34.0 35.0 32.0 36.0 90-91 33.920874999999995 35.0 34.0 35.0 32.0 36.0 92-93 33.7375 35.0 34.0 35.0 31.5 36.0 94-95 33.723375 35.0 34.0 35.0 32.0 36.0 96-97 33.349625 35.0 34.0 35.0 31.0 35.0 98-99 33.17725 35.0 34.0 35.0 31.0 35.0 100 33.17275 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.3814114634330039 1101 2 -0.3160854610730368 1101 3 -0.13227134643870642 1101 4 -0.028733900730586015 1101 5 0.0522582912806584 1101 6 0.0418267178830547 1101 7 -6.904170118744446E-4 1101 8 -0.08109261630387721 1101 9 -0.039353769676885975 1101 10-11 0.08641510381361428 1101 12-13 0.02221259822751165 1101 14-15 0.03922196279279433 1101 16-17 0.01777509979663705 1101 18-19 0.011115713891186374 1101 20-21 -0.0028934749315894237 1101 22-23 -0.08326429163214044 1101 24-25 0.0722615550701704 1101 26-27 -0.17141799101202793 1101 28-29 0.037772087067857285 1101 30-31 0.1649469006552664 1101 32-33 -0.0399688684692876 1101 34-35 -0.020656021691642934 1101 36-37 -0.023059928196630608 1101 38-39 -0.3777961888980954 1101 40-41 -0.15802390098164665 1101 42-43 -0.13030679621400765 1101 44-45 -0.023913534684041338 1101 46-47 0.08639627425874608 1101 48-49 -0.09175014435992068 1101 50-51 0.027032964274056326 1101 52-53 -0.038406015415127115 1101 54-55 -0.2757023423966274 1101 56-57 -0.3926840902814419 1101 58-59 -0.08307599608345129 1101 60-61 -0.19968742938916506 1101 62-63 0.012201551555321544 1101 64-65 0.01124124425698625 1101 66-67 -0.025294368707790227 1101 68-69 0.07681203083025423 1101 70-71 0.07484748060555546 1101 72-73 0.06206221284928404 1101 74-75 -0.08124952926112883 1101 76-77 0.2441063493259037 1101 78-79 -0.00935828877005207 1101 80-81 -0.15856995807286012 1101 82-83 0.016061610303538032 1101 84-85 -0.1344932339132825 1101 86-87 -0.09799528005824953 1101 88-89 -0.15816826090231473 1101 90-91 -0.15654891918354963 1101 92-93 -0.11717631995179545 1101 94-95 -0.19844467876779248 1101 96-97 -0.3015239386407558 1101 98-99 -0.4371908814742227 1101 100 -0.5450402952474178 1105 1 0.3814114634330039 1105 2 0.3160854610730297 1105 3 0.1322713464386993 1105 4 0.028733900730586015 1105 5 -0.0522582912806584 1105 6 -0.0418267178830547 1105 7 6.904170118744446E-4 1105 8 0.08109261630388431 1105 9 0.039353769676885975 1105 10-11 -0.08641510381361428 1105 12-13 -0.02221259822751165 1105 14-15 -0.039221962792801435 1105 16-17 -0.017775099796644156 1105 18-19 -0.011115713891186374 1105 20-21 0.0028934749315894237 1105 22-23 0.08326429163214755 1105 24-25 -0.0722615550701704 1105 26-27 0.17141799101202793 1105 28-29 -0.037772087067857285 1105 30-31 -0.1649469006552664 1105 32-33 0.039968868469280494 1105 34-35 0.02065602169165004 1105 36-37 0.023059928196630608 1105 38-39 0.3777961888980954 1105 40-41 0.15802390098164665 1105 42-43 0.13030679621400765 1105 44-45 0.023913534684041338 1105 46-47 -0.08639627425873897 1105 48-49 0.09175014435992068 1105 50-51 -0.027032964274056326 1105 52-53 0.038406015415127115 1105 54-55 0.2757023423966274 1105 56-57 0.3926840902814419 1105 58-59 0.08307599608345839 1105 60-61 0.19968742938917217 1105 62-63 -0.012201551555321544 1105 64-65 -0.01124124425698625 1105 66-67 0.025294368707790227 1105 68-69 -0.07681203083025423 1105 70-71 -0.07484748060555546 1105 72-73 -0.06206221284928404 1105 74-75 0.08124952926112883 1105 76-77 -0.2441063493258966 1105 78-79 0.00935828877005207 1105 80-81 0.15856995807286012 1105 82-83 -0.016061610303530927 1105 84-85 0.1344932339132825 1105 86-87 0.09799528005824953 1105 88-89 0.15816826090231473 1105 90-91 0.15654891918354963 1105 92-93 0.11717631995179545 1105 94-95 0.19844467876779248 1105 96-97 0.3015239386407558 1105 98-99 0.4371908814742298 1105 100 0.5450402952474178 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 2.0 18 3.0 19 4.0 20 1.0 21 4.0 22 2.0 23 7.0 24 3.0 25 8.0 26 11.0 27 14.0 28 15.0 29 24.0 30 22.0 31 33.0 32 50.0 33 78.0 34 92.0 35 138.0 36 283.0 37 842.0 38 1870.0 39 492.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.733938019652307 14.940791131267323 20.055429579239103 41.269841269841265 2 21.349999999999998 22.400000000000002 36.1 20.150000000000002 3 23.325000000000003 26.3 26.75 23.625 4 24.224999999999998 32.425 21.25 22.1 5 25.374999999999996 34.725 21.925 17.974999999999998 6 17.7 39.7 23.674999999999997 18.925 7 16.725 18.625 45.375 19.275000000000002 8 19.425 23.9 29.849999999999998 26.825 9 19.575 23.375 31.3 25.75 10-11 21.5 34.4375 22.7125 21.349999999999998 12-13 20.45 27.474999999999998 29.1875 22.8875 14-15 20.9 28.025 28.8875 22.1875 16-17 22.3 28.037499999999998 28.425 21.2375 18-19 22.05 28.5625 27.6 21.7875 20-21 21.099999999999998 28.037499999999998 29.099999999999998 21.762500000000003 22-23 21.325 27.762500000000003 28.499999999999996 22.412499999999998 24-25 21.075 28.4 27.8875 22.6375 26-27 20.4125 29.725 27.925 21.9375 28-29 21.4 28.425 28.475 21.7 30-31 22.275 28.9 27.187499999999996 21.637500000000003 32-33 20.7125 28.449999999999996 28.9375 21.9 34-35 21.512500000000003 27.625 28.6625 22.2 36-37 21.3875 29.175 27.700000000000003 21.7375 38-39 21.425 28.6625 27.487499999999997 22.425 40-41 20.95 28.299999999999997 28.775000000000002 21.975 42-43 21.337500000000002 28.849999999999998 28.787499999999998 21.025 44-45 21.375 29.1875 28.199999999999996 21.2375 46-47 21.2375 29.0875 27.700000000000003 21.975 48-49 21.725 28.125 28.1625 21.987499999999997 50-51 20.3625 29.525000000000002 28.199999999999996 21.912499999999998 52-53 21.7 27.725 28.999999999999996 21.575 54-55 21.7875 28.0625 28.799999999999997 21.349999999999998 56-57 21.55 29.075 28.1 21.275 58-59 22.1375 28.875 27.375 21.6125 60-61 21.512500000000003 28.512500000000003 28.349999999999998 21.625 62-63 22.0125 28.237499999999997 28.375 21.375 64-65 22.0875 28.799999999999997 27.625 21.4875 66-67 20.974999999999998 29.599999999999998 27.962500000000002 21.462500000000002 68-69 20.95 28.8875 28.325 21.837500000000002 70-71 21.875 27.900000000000002 28.025 22.2 72-73 20.9875 28.1375 29.512500000000003 21.3625 74-75 22.5625 27.975 27.500000000000004 21.9625 76-77 21.3625 29.099999999999998 28.175 21.3625 78-79 21.575 28.599999999999998 28.599999999999998 21.224999999999998 80-81 21.3875 28.4 28.3375 21.875 82-83 21.7 28.175 28.712500000000002 21.4125 84-85 21.4375 28.462500000000002 27.5625 22.537499999999998 86-87 21.462500000000002 28.462500000000002 29.5 20.575 88-89 21.275 28.775000000000002 28.849999999999998 21.099999999999998 90-91 20.474999999999998 28.449999999999996 29.75 21.325 92-93 22.3875 28.037499999999998 28.262500000000003 21.3125 94-95 21.3625 27.875 28.787499999999998 21.975 96-97 21.475 28.1625 28.537499999999998 21.825 98-99 21.1625 29.7 28.1125 21.025 100 21.125 29.025000000000002 28.599999999999998 21.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.5 24 3.0 25 3.5 26 4.0 27 5.0 28 12.0 29 19.0 30 26.0 31 33.0 32 42.5 33 58.0 34 74.5 35 87.5 36 112.5 37 138.0 38 155.5 39 183.0 40 201.5 41 227.5 42 240.5 43 248.5 44 267.0 45 268.0 46 269.5 47 254.5 48 223.5 49 181.5 50 147.0 51 119.5 52 91.0 53 77.0 54 56.0 55 41.0 56 31.0 57 20.0 58 15.0 59 10.0 60 9.0 61 9.0 62 8.0 63 5.5 64 3.0 65 2.5 66 1.5 67 1.5 68 1.5 69 2.5 70 2.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816228 spots for SRR3241528.sra Written 816228 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra Read 816219 spots for SRR3241528.sra Written 816219 spots for SRR3241528.sra SRR ids: ['SRR3241528.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v91_nvpx SRR3241528.sra spots: 16324389 blocks: [[1, 816219], [816220, 1632438], [1632439, 2448657], [2448658, 3264876], [3264877, 4081095], [4081096, 4897314], [4897315, 5713533], [5713534, 6529752], [6529753, 7345971], [7345972, 8162190], [8162191, 8978409], [8978410, 9794628], [9794629, 10610847], [10610848, 11427066], [11427067, 12243285], [12243286, 13059504], [13059505, 13875723], [13875724, 14691942], [14691943, 15508161], [15508162, 16324389]] SRR3241528 file size 4253345 SRR3241528 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241528 SRR3241528_1.fastq Input file: SRR3241528_1.fastq trimmed: SRR3241528-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:49:10 2025 >> started Mon Feb 10 15:49:26 2025 >> done (15.933s) 16324389 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 16324389 (100.00%) reads available; of these: 655377 ( 4.01%) trimmed reads available after processing 15669012 (95.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 46 1 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 1 0.00% 51 1389 0.01% 52 1942 0.01% 53 2408 0.01% 54 3032 0.02% 55 3414 0.02% 56 3616 0.02% 57 4054 0.02% 58 4314 0.03% 59 4537 0.03% 60 4622 0.03% 61 4861 0.03% 62 4854 0.03% 63 5015 0.03% 64 5113 0.03% 65 5418 0.03% 66 5525 0.03% 67 5727 0.04% 68 6045 0.04% 69 6116 0.04% 70 6531 0.04% 71 6886 0.04% 72 7302 0.04% 73 7540 0.05% 74 7932 0.05% 75 8369 0.05% 76 5081 0.03% 77 5724 0.04% 78 6544 0.04% 79 7146 0.04% 80 7698 0.05% 81 8247 0.05% 82 9072 0.06% 83 9591 0.06% 84 10231 0.06% 85 11006 0.07% 86 11581 0.07% 87 12525 0.08% 88 13688 0.08% 89 15097 0.09% 90 16950 0.10% 91 18926 0.12% 92 21473 0.13% 93 25200 0.15% 94 30522 0.19% 95 34792 0.21% 96 42677 0.26% 97 56915 0.35% 98 77451 0.47% 99 70675 0.43% 100 15669012 95.99% 16324389 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=32 prefix-density=0.09 prefix-fanout=2.7 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=239.68 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=26.0 sequence=TTCTTCTTCTTT Started job on | Feb 10 15:49:44 Started mapping on | Feb 10 15:49:44 Finished on | Feb 10 15:50:03 Mapping speed, Million of reads per hour | 3093.04 Number of input reads | 16324389 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15772160 Uniquely mapped reads % | 96.62% Average mapped length | 99.24 Number of splices: Total | 4134478 Number of splices: Annotated (sjdb) | 4048087 Number of splices: GT/AG | 4069486 Number of splices: GC/AG | 53130 Number of splices: AT/AC | 4266 Number of splices: Non-canonical | 7596 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.10 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364457 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 119178 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.42% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 187772 187772 187772 N_multimapping 364457 364457 364457 N_noFeature 774756 8178685 8252712 N_ambiguous 172952 28633 29101 UnstrandedReadsAssigned:14824452 PositiveStrandReadsAssigned:7564842 NegativeStrandReadsAssigned:7490347 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241528 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241528-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,324,389 reads, 15,236,242 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR3241528.ke.tsv 34699 SRR3241528.se.tsv 87100 total ==> SRR3241528.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 530 25.4448 Potri.005G024800.1.v4.1 1035 936 207 20.3748 Potri.004G059700.1.v4.1 961 862 13 1.38942 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 200.308 6.48884 Potri.016G087400.1.v4.1 270 171 604 325.416 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 68.6959 3.78071 Potri.012G127500.1.v4.1 977 878 1800 188.876 ==> SRR3241528.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2592 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR3241528 completed mapping pipeline successfully