Starting /dee2/code/volunteer_pipeline.sh SRR3241529 current disk space = 3059097772032 free memory = 1015641288 SRR3241529 SRAfilesize 56056f02b560db3052efcf2e0d04c249 SRR3241529.sra SRR3241529.sra file validated SRR3241529 is single end SRR3241529 is conventional basespace SRR3241529 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241529_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03775 34.0 33.0 34.0 31.0 34.0 2 33.21325 34.0 34.0 34.0 31.0 34.0 3 33.3375 34.0 34.0 34.0 31.0 34.0 4 36.59975 37.0 37.0 37.0 35.0 37.0 5 36.55125 37.0 37.0 37.0 35.0 37.0 6 36.57125 37.0 37.0 37.0 35.0 37.0 7 36.556 37.0 37.0 37.0 35.0 37.0 8 36.485 37.0 37.0 37.0 35.0 37.0 9 38.18625 39.0 39.0 39.0 37.0 39.0 10-11 38.329 39.0 39.0 39.0 37.0 39.0 12-13 38.333124999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.982749999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.935375 41.0 40.0 41.0 38.0 41.0 18-19 39.965 41.0 40.0 41.0 38.0 41.0 20-21 39.917 41.0 40.0 41.0 38.0 41.0 22-23 39.888625 41.0 40.0 41.0 38.0 41.0 24-25 39.903999999999996 41.0 40.0 41.0 38.0 41.0 26-27 39.70225 41.0 40.0 41.0 38.0 41.0 28-29 39.687875 41.0 40.0 41.0 38.0 41.0 30-31 39.628875 41.0 40.0 41.0 37.5 41.0 32-33 39.532875000000004 41.0 39.0 41.0 37.0 41.0 34-35 39.4725 41.0 39.0 41.0 37.0 41.0 36-37 39.64275 41.0 39.5 41.0 37.5 41.0 38-39 39.432625 41.0 40.0 41.0 37.0 41.0 40-41 39.648624999999996 41.0 40.0 41.0 37.0 41.0 42-43 39.710875 41.0 40.0 41.0 37.5 41.0 44-45 39.657125 41.0 40.0 41.0 37.0 41.0 46-47 39.681375 41.0 40.0 41.0 37.0 41.0 48-49 39.530875 41.0 40.0 41.0 37.0 41.0 50-51 39.480999999999995 41.0 39.5 41.0 36.5 41.0 52-53 39.30925 41.0 39.0 41.0 35.5 41.0 54-55 38.96525 40.0 39.0 41.0 35.0 41.0 56-57 38.821875 40.0 38.5 41.0 35.0 41.0 58-59 38.901625 40.0 38.0 41.0 35.0 41.0 60-61 38.748374999999996 40.0 38.0 41.0 35.0 41.0 62-63 38.446375 40.0 37.0 41.0 35.0 41.0 64-65 38.1755 39.5 37.0 41.0 35.0 41.0 66-67 37.827375 39.0 36.0 41.0 34.0 41.0 68-69 37.49875 39.0 36.0 40.5 34.0 41.0 70-71 37.110375 37.5 35.0 40.0 34.0 41.0 72-73 36.747125 37.0 35.0 39.0 34.0 41.0 74-75 36.286874999999995 37.0 35.0 39.0 34.0 40.5 76-77 34.888125 35.0 34.0 37.0 31.5 39.0 78-79 35.332499999999996 36.0 35.0 37.0 33.0 39.0 80-81 35.092625 35.0 35.0 37.0 33.0 39.0 82-83 34.802625 35.0 35.0 36.5 33.0 37.5 84-85 34.5125 35.0 35.0 36.0 33.0 37.0 86-87 34.327875000000006 35.0 35.0 36.0 33.0 37.0 88-89 34.098 35.0 34.5 35.0 32.5 36.0 90-91 33.90175 35.0 34.0 35.0 32.0 36.0 92-93 33.79600000000001 35.0 34.0 35.0 32.0 36.0 94-95 33.738 35.0 34.0 35.0 32.0 36.0 96-97 33.380250000000004 35.0 34.0 35.0 31.0 35.0 98-99 33.25 35.0 34.0 35.0 31.0 35.0 100 33.14925 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.13616278777836044 1101 2 -0.06112073510582405 1101 3 0.007669905350105921 1101 4 0.004782706936801162 1101 5 0.04188948306595108 1101 6 0.08969144636087378 1101 7 0.1410082598980651 1101 8 0.2147071376565961 1101 9 0.20571916346563768 1101 10-11 0.1806758554894401 1101 12-13 0.04023875875574845 1101 14-15 0.01930029374105402 1101 16-17 0.20202229419296458 1101 18-19 0.13651427280258588 1101 20-21 0.055666440712009546 1101 22-23 -0.005014938113525602 1101 24-25 0.09341969822499863 1101 26-27 0.06199944766638765 1101 28-29 0.025576812030834617 1101 30-31 0.07321558585021393 1101 32-33 -0.08364088272953296 1101 34-35 0.31759810198087024 1101 36-37 0.22968918681429074 1101 38-39 -0.17039491853078914 1101 40-41 0.011492304988578894 1101 42-43 0.3115914739775505 1101 44-45 0.21424267530315433 1101 46-47 0.29434987823554337 1101 48-49 0.19043584143004466 1101 50-51 0.2981660013557246 1101 52-53 0.07715096281790323 1101 54-55 -0.17807110039918683 1101 56-57 -0.3060995204740067 1101 58-59 0.05128543094574667 1101 60-61 0.23103863824658788 1101 62-63 0.06451005498229989 1101 64-65 0.2008611383093566 1101 66-67 0.1816738218975189 1101 68-69 0.30924405613718164 1101 70-71 0.47490647987748247 1101 72-73 0.348227511234974 1101 74-75 0.24553739549597253 1101 76-77 0.5317340764730929 1101 78-79 0.3388943285380748 1101 80-81 0.00973487986744459 1101 82-83 0.07322813888679747 1101 84-85 0.20612086063619017 1101 86-87 0.011755918756747974 1101 88-89 0.11285807536843606 1101 90-91 0.15007155230850344 1101 92-93 -0.12324571313800448 1101 94-95 -0.3131668800682945 1101 96-97 -0.3103173407647333 1101 98-99 -0.04685420903316384 1101 100 0.0785569029148192 1105 1 0.13616278777836754 1105 2 0.06112073510581695 1105 3 -0.007669905350098816 1105 4 -0.0047827069368082675 1105 5 -0.04188948306595108 1105 6 -0.08969144636087378 1105 7 -0.1410082598980722 1105 8 -0.2147071376566032 1105 9 -0.20571916346564478 1105 10-11 -0.1806758554894401 1105 12-13 -0.040238758755741344 1105 14-15 -0.019300293741061125 1105 16-17 -0.20202229419296458 1105 18-19 -0.13651427280259298 1105 20-21 -0.055666440712009546 1105 22-23 0.005014938113532708 1105 24-25 -0.09341969822500573 1105 26-27 -0.06199944766639476 1105 28-29 -0.025576812030834617 1105 30-31 -0.07321558585021393 1105 32-33 0.08364088272953296 1105 34-35 -0.31759810198087024 1105 36-37 -0.22968918681429074 1105 38-39 0.17039491853078914 1105 40-41 -0.011492304988578894 1105 42-43 -0.3115914739775505 1105 44-45 -0.21424267530315433 1105 46-47 -0.2943498782355505 1105 48-49 -0.19043584143003756 1105 50-51 -0.2981660013557246 1105 52-53 -0.07715096281790323 1105 54-55 0.17807110039918683 1105 56-57 0.3060995204740067 1105 58-59 -0.05128543094574667 1105 60-61 -0.23103863824659499 1105 62-63 -0.06451005498229989 1105 64-65 -0.2008611383093566 1105 66-67 -0.1816738218975189 1105 68-69 -0.30924405613717454 1105 70-71 -0.47490647987748247 1105 72-73 -0.34822751123496687 1105 74-75 -0.24553739549597253 1105 76-77 -0.5317340764731 1105 78-79 -0.3388943285380748 1105 80-81 -0.009734879867437485 1105 82-83 -0.07322813888679747 1105 84-85 -0.20612086063618307 1105 86-87 -0.011755918756740869 1105 88-89 -0.11285807536843606 1105 90-91 -0.15007155230850344 1105 92-93 0.12324571313800448 1105 94-95 0.3131668800682945 1105 96-97 0.3103173407647333 1105 98-99 0.04685420903316384 1105 100 -0.0785569029148121 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 2.0 18 2.0 19 1.0 20 5.0 21 4.0 22 2.0 23 6.0 24 4.0 25 12.0 26 9.0 27 7.0 28 14.0 29 29.0 30 26.0 31 37.0 32 50.0 33 52.0 34 87.0 35 154.0 36 298.0 37 793.0 38 1871.0 39 533.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.169896803423107 14.397180971558015 17.89579662723383 42.53712559778505 2 20.0 22.35 36.275 21.375 3 22.6 26.974999999999998 25.650000000000002 24.775 4 23.549999999999997 33.175 20.05 23.225 5 23.724999999999998 37.325 22.175 16.775000000000002 6 18.775 39.45 23.25 18.525 7 16.45 18.925 44.1 20.525 8 19.75 25.3 28.425 26.525 9 19.0 24.75 31.525 24.725 10-11 21.712500000000002 34.300000000000004 22.5875 21.4 12-13 19.8375 27.224999999999998 30.012499999999996 22.925 14-15 20.9875 28.65 28.8375 21.525 16-17 21.675 28.487499999999997 28.249999999999996 21.587500000000002 18-19 21.4875 28.575 27.775 22.162499999999998 20-21 21.25 28.7375 27.787499999999998 22.225 22-23 21.224999999999998 28.4 28.125 22.25 24-25 21.837500000000002 28.8375 27.825 21.5 26-27 21.2375 29.4125 28.025 21.325 28-29 21.212500000000002 28.425 28.3875 21.975 30-31 21.875 29.4125 27.3375 21.375 32-33 20.8875 28.712500000000002 28.1125 22.287499999999998 34-35 21.2875 28.1 29.175 21.4375 36-37 20.9125 29.25 27.775 22.0625 38-39 21.4 28.3625 28.462500000000002 21.775 40-41 21.65 29.512500000000003 26.875 21.9625 42-43 21.337500000000002 28.787499999999998 28.712500000000002 21.1625 44-45 21.1375 29.175 27.737499999999997 21.95 46-47 21.625 29.612500000000004 27.4125 21.349999999999998 48-49 21.875 28.125 28.5875 21.4125 50-51 21.0375 28.5625 28.799999999999997 21.6 52-53 22.0625 28.812500000000004 28.199999999999996 20.925 54-55 21.325 28.8875 27.525 22.2625 56-57 21.099999999999998 28.6375 28.825 21.4375 58-59 21.4375 28.8875 27.875 21.8 60-61 21.0625 28.449999999999996 28.5625 21.925 62-63 21.349999999999998 28.349999999999998 28.3625 21.9375 64-65 21.349999999999998 28.449999999999996 29.4375 20.7625 66-67 21.0625 29.1375 27.675 22.125 68-69 21.0625 29.1375 27.8125 21.987499999999997 70-71 21.1125 29.012500000000003 28.1875 21.6875 72-73 21.2375 27.9375 29.025000000000002 21.8 74-75 21.6625 28.9125 27.8375 21.587500000000002 76-77 20.6125 28.237499999999997 29.675 21.475 78-79 21.212500000000002 28.725 27.9375 22.125 80-81 21.637500000000003 29.262500000000003 28.299999999999997 20.8 82-83 21.825 28.475 28.462500000000002 21.2375 84-85 21.5 28.725 28.1625 21.6125 86-87 21.2 28.9375 28.449999999999996 21.4125 88-89 22.0 28.712500000000002 27.8875 21.4 90-91 21.95 28.7 27.8375 21.512500000000003 92-93 21.975 28.975 28.275 20.775 94-95 20.9875 29.2875 28.762500000000003 20.962500000000002 96-97 21.05 28.037499999999998 28.9375 21.975 98-99 21.1375 28.549999999999997 28.6375 21.675 100 22.025 28.175 28.1 21.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 3.0 24 3.0 25 4.0 26 7.0 27 9.5 28 10.0 29 14.5 30 25.5 31 34.0 32 46.0 33 73.5 34 85.5 35 98.0 36 122.5 37 137.0 38 151.5 39 172.0 40 206.0 41 238.0 42 250.5 43 252.0 44 253.0 45 252.0 46 242.5 47 234.0 48 210.0 49 173.0 50 137.5 51 111.5 52 101.5 53 82.5 54 65.0 55 47.0 56 32.5 57 25.5 58 19.0 59 14.5 60 9.0 61 7.5 62 8.0 63 7.5 64 4.5 65 1.5 66 3.5 67 4.0 68 2.0 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695730 spots for SRR3241529.sra Written 695730 spots for SRR3241529.sra Read 695736 spots for SRR3241529.sra Written 695736 spots for SRR3241529.sra SRR ids: ['SRR3241529.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ap5dy6qy SRR3241529.sra spots: 13914606 blocks: [[1, 695730], [695731, 1391460], [1391461, 2087190], [2087191, 2782920], [2782921, 3478650], [3478651, 4174380], [4174381, 4870110], [4870111, 5565840], [5565841, 6261570], [6261571, 6957300], [6957301, 7653030], [7653031, 8348760], [8348761, 9044490], [9044491, 9740220], [9740221, 10435950], [10435951, 11131680], [11131681, 11827410], [11827411, 12523140], [12523141, 13218870], [13218871, 13914606]] SRR3241529 file size 3623872 SRR3241529 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241529 SRR3241529_1.fastq Input file: SRR3241529_1.fastq trimmed: SRR3241529-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:30:00 2025 >> started Mon Feb 10 15:30:08 2025 >> done (7.929s) 13914606 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 13914606 (100.00%) reads available; of these: 557055 ( 4.00%) trimmed reads available after processing 13357551 (96.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 51 1362 0.01% 52 1728 0.01% 53 2195 0.02% 54 2625 0.02% 55 2904 0.02% 56 3162 0.02% 57 3459 0.02% 58 3648 0.03% 59 3868 0.03% 60 4010 0.03% 61 4082 0.03% 62 4305 0.03% 63 4172 0.03% 64 4449 0.03% 65 4571 0.03% 66 4771 0.03% 67 5039 0.04% 68 5133 0.04% 69 5307 0.04% 70 5664 0.04% 71 5790 0.04% 72 6048 0.04% 73 6274 0.05% 74 6634 0.05% 75 7171 0.05% 76 4304 0.03% 77 4753 0.03% 78 5670 0.04% 79 6292 0.05% 80 6582 0.05% 81 7011 0.05% 82 7566 0.05% 83 8096 0.06% 84 8669 0.06% 85 9290 0.07% 86 9790 0.07% 87 10643 0.08% 88 11929 0.09% 89 12943 0.09% 90 14152 0.10% 91 16199 0.12% 92 18307 0.13% 93 21474 0.15% 94 25360 0.18% 95 29506 0.21% 96 35947 0.26% 97 48894 0.35% 98 65273 0.47% 99 60034 0.43% 100 13357551 96.00% 13914606 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=32 prefix-density=0.06 prefix-fanout=2.6 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=254.36 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=23.3 sequence=AAGAAGAAGAAG Started job on | Feb 10 15:30:27 Started mapping on | Feb 10 15:30:27 Finished on | Feb 10 15:30:41 Mapping speed, Million of reads per hour | 3578.04 Number of input reads | 13914606 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13402809 Uniquely mapped reads % | 96.32% Average mapped length | 99.24 Number of splices: Total | 3454938 Number of splices: Annotated (sjdb) | 3374969 Number of splices: GT/AG | 3397561 Number of splices: GC/AG | 46655 Number of splices: AT/AC | 3827 Number of splices: Non-canonical | 6895 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330761 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 97354 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.60% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 181036 181036 181036 N_multimapping 330761 330761 330761 N_noFeature 702686 6981729 7031586 N_ambiguous 143215 25409 25964 UnstrandedReadsAssigned:12556908 PositiveStrandReadsAssigned:6395671 NegativeStrandReadsAssigned:6345259 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241529 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241529-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,914,606 reads, 12,907,632 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52401 SRR3241529.ke.tsv 34699 SRR3241529.se.tsv 87100 total ==> SRR3241529.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 543 29.7642 Potri.005G024800.1.v4.1 1035 936 312 35.0629 Potri.004G059700.1.v4.1 961 862 10 1.22029 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 259.793 9.60874 Potri.016G087400.1.v4.1 270 171 488 300.188 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 50 3.14184 Potri.012G127500.1.v4.1 977 878 1890 226.431 ==> SRR3241529.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1805 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR3241529 completed mapping pipeline successfully