Starting /dee2/code/volunteer_pipeline.sh SRR3241530 current disk space = 3059092381696 free memory = 1414018364 SRR3241530 SRAfilesize 0c6a71909ed1b13a768b0ad4e0477b18 SRR3241530.sra SRR3241530.sra file validated SRR3241530 is single end SRR3241530 is conventional basespace SRR3241530 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241530_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07925 34.0 33.0 34.0 31.0 34.0 2 33.19275 34.0 34.0 34.0 31.0 34.0 3 33.3175 34.0 34.0 34.0 31.0 34.0 4 36.546 37.0 37.0 37.0 35.0 37.0 5 36.47975 37.0 37.0 37.0 35.0 37.0 6 36.509 37.0 37.0 37.0 35.0 37.0 7 36.5445 37.0 37.0 37.0 35.0 37.0 8 36.5175 37.0 37.0 37.0 35.0 37.0 9 38.271 39.0 39.0 39.0 37.0 39.0 10-11 38.368375 39.0 39.0 39.0 37.0 39.0 12-13 38.278375 39.0 39.0 39.0 37.0 39.0 14-15 39.905375 41.0 40.0 41.0 38.0 41.0 16-17 39.88175 41.0 40.0 41.0 38.0 41.0 18-19 39.908375 41.0 40.0 41.0 38.0 41.0 20-21 39.86325 41.0 40.0 41.0 38.0 41.0 22-23 39.790375 41.0 40.0 41.0 38.0 41.0 24-25 39.740125000000006 41.0 40.0 41.0 38.0 41.0 26-27 39.628875 41.0 40.0 41.0 37.0 41.0 28-29 39.654624999999996 41.0 40.0 41.0 37.5 41.0 30-31 39.536874999999995 41.0 40.0 41.0 37.0 41.0 32-33 39.326 41.0 39.0 41.0 36.5 41.0 34-35 39.319 41.0 39.0 41.0 36.5 41.0 36-37 39.436125000000004 41.0 39.0 41.0 37.0 41.0 38-39 39.250625 41.0 39.0 41.0 36.0 41.0 40-41 39.49025 41.0 40.0 41.0 37.0 41.0 42-43 39.577625 41.0 40.0 41.0 37.0 41.0 44-45 39.4775 41.0 40.0 41.0 36.5 41.0 46-47 39.515 41.0 40.0 41.0 37.0 41.0 48-49 39.419375 41.0 39.5 41.0 36.5 41.0 50-51 39.326499999999996 41.0 39.0 41.0 36.0 41.0 52-53 38.970124999999996 41.0 39.0 41.0 35.0 41.0 54-55 38.68025 40.0 38.0 41.0 35.0 41.0 56-57 38.514 40.0 38.0 41.0 34.5 41.0 58-59 38.606375 40.0 38.0 41.0 35.0 41.0 60-61 38.485 40.0 37.5 41.0 35.0 41.0 62-63 38.205125 40.0 37.0 41.0 34.5 41.0 64-65 37.839875000000006 39.0 36.5 41.0 34.0 41.0 66-67 37.403125 39.0 36.0 41.0 34.0 41.0 68-69 37.22625 38.5 35.5 40.5 34.0 41.0 70-71 36.851 37.5 35.0 40.0 33.5 41.0 72-73 36.458375000000004 37.0 35.0 39.0 33.0 41.0 74-75 35.971125 36.5 35.0 39.0 33.0 40.5 76-77 34.574124999999995 35.0 33.5 37.0 30.5 39.0 78-79 34.94925 35.0 35.0 37.0 32.0 39.0 80-81 34.769375 35.0 35.0 37.0 32.0 39.0 82-83 34.43125 35.0 35.0 36.0 31.5 37.0 84-85 34.2285 35.0 35.0 36.0 32.0 37.0 86-87 33.937125 35.0 34.5 36.0 32.0 36.5 88-89 33.852125 35.0 34.0 35.0 31.5 36.0 90-91 33.70325 35.0 34.0 35.0 31.0 36.0 92-93 33.54675 35.0 34.0 35.0 31.0 36.0 94-95 33.488749999999996 35.0 34.0 35.0 31.5 36.0 96-97 33.116 35.0 34.0 35.0 31.0 35.0 98-99 32.9185 35.0 34.0 35.0 30.5 35.0 100 32.82575 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0622996794871824 1101 2 0.1087740384615401 1101 3 0.1069711538461533 1101 4 0.1366185897435912 1101 5 0.2379807692307665 1101 6 0.1476362179487154 1101 7 0.1205929487179489 1101 8 0.1131810897435912 1101 9 0.4783653846153797 1101 10-11 0.1958133012820511 1101 12-13 0.0684094551282044 1101 14-15 0.1870993589743577 1101 16-17 0.1916065705128176 1101 18-19 0.1229967948717956 1101 20-21 0.1838942307692335 1101 22-23 0.1591546474358978 1101 24-25 0.5157251602564159 1101 26-27 0.4441105769230802 1101 28-29 0.2753405448717956 1101 30-31 0.4699519230769269 1101 32-33 0.4054487179487154 1101 34-35 0.4515224358974308 1101 36-37 0.3832131410256423 1101 38-39 -0.030548878205124197 1101 40-41 0.3343349358974379 1101 42-43 0.4499198717948758 1101 44-45 0.2912660256410291 1101 46-47 0.2900641025641022 1101 48-49 0.2075320512820582 1101 50-51 0.3551682692307665 1101 52-53 0.4658453525641022 1101 54-55 0.0122195512820511 1101 56-57 -0.010516826923080203 1101 58-59 0.2032251602564159 1101 60-61 0.2602163461538467 1101 62-63 0.2896634615384599 1101 64-65 0.3402443910256423 1101 66-67 0.1052684294871824 1101 68-69 0.3575721153846203 1101 70-71 0.2459935897435841 1101 72-73 0.412960737179489 1101 74-75 0.4678485576923066 1101 76-77 0.518429487179489 1101 78-79 0.4573317307692335 1101 80-81 0.3797075320512846 1101 82-83 0.7561097756410291 1101 84-85 0.7376802884615401 1101 86-87 0.7842548076923066 1101 88-89 0.516726762820511 1101 90-91 0.5376602564102555 1101 92-93 0.7870592948717956 1101 94-95 0.6721754807692335 1101 96-97 0.4241786858974308 1101 98-99 0.432491987179489 1101 100 0.5941506410256352 1105 1 -0.0622996794871753 1105 2 -0.1087740384615401 1105 3 -0.1069711538461533 1105 4 -0.1366185897435912 1105 5 -0.2379807692307736 1105 6 -0.1476362179487154 1105 7 -0.1205929487179489 1105 8 -0.1131810897435912 1105 9 -0.4783653846153868 1105 10-11 -0.1958133012820511 1105 12-13 -0.0684094551282044 1105 14-15 -0.1870993589743577 1105 16-17 -0.1916065705128176 1105 18-19 -0.1229967948717885 1105 20-21 -0.1838942307692264 1105 22-23 -0.1591546474358978 1105 24-25 -0.5157251602564088 1105 26-27 -0.4441105769230802 1105 28-29 -0.2753405448717885 1105 30-31 -0.4699519230769198 1105 32-33 -0.4054487179487225 1105 34-35 -0.4515224358974379 1105 36-37 -0.3832131410256423 1105 38-39 0.030548878205124197 1105 40-41 -0.3343349358974308 1105 42-43 -0.4499198717948687 1105 44-45 -0.2912660256410291 1105 46-47 -0.2900641025640951 1105 48-49 -0.2075320512820511 1105 50-51 -0.3551682692307665 1105 52-53 -0.4658453525641022 1105 54-55 -0.0122195512820511 1105 56-57 0.010516826923080203 1105 58-59 -0.2032251602564088 1105 60-61 -0.2602163461538467 1105 62-63 -0.2896634615384599 1105 64-65 -0.3402443910256423 1105 66-67 -0.1052684294871824 1105 68-69 -0.3575721153846132 1105 70-71 -0.2459935897435912 1105 72-73 -0.4129607371794819 1105 74-75 -0.4678485576923066 1105 76-77 -0.518429487179489 1105 78-79 -0.4573317307692264 1105 80-81 -0.3797075320512775 1105 82-83 -0.7561097756410291 1105 84-85 -0.7376802884615401 1105 86-87 -0.7842548076923066 1105 88-89 -0.5167267628205181 1105 90-91 -0.5376602564102555 1105 92-93 -0.7870592948717956 1105 94-95 -0.6721754807692264 1105 96-97 -0.4241786858974308 1105 98-99 -0.432491987179489 1105 100 -0.5941506410256423 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 6.0 19 3.0 20 4.0 21 7.0 22 8.0 23 5.0 24 8.0 25 13.0 26 20.0 27 14.0 28 19.0 29 25.0 30 39.0 31 48.0 32 59.0 33 65.0 34 99.0 35 155.0 36 271.0 37 771.0 38 1869.0 39 491.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.471830985915492 15.3420523138833 18.46076458752515 41.725352112676056 2 20.575 23.474999999999998 35.85 20.1 3 22.425 26.974999999999998 27.450000000000003 23.150000000000002 4 24.275 32.0 20.625 23.1 5 24.474999999999998 34.9 23.925 16.7 6 17.875 39.574999999999996 24.474999999999998 18.075 7 15.875 18.7 44.425 21.0 8 19.775000000000002 23.549999999999997 29.4 27.275 9 21.15 24.025 31.125000000000004 23.7 10-11 21.825 35.4125 22.075 20.6875 12-13 20.4375 27.125 30.15 22.287499999999998 14-15 21.3875 27.9125 29.3875 21.3125 16-17 21.875 27.775 29.049999999999997 21.3 18-19 20.9875 28.849999999999998 27.800000000000004 22.3625 20-21 21.4125 28.462500000000002 28.725 21.4 22-23 21.4 29.15 27.287499999999998 22.162499999999998 24-25 20.925 29.849999999999998 28.050000000000004 21.175 26-27 21.7 28.9 27.487499999999997 21.912499999999998 28-29 21.3625 28.525 28.212500000000002 21.9 30-31 20.9375 28.4125 28.8375 21.8125 32-33 21.8125 28.875 27.35 21.9625 34-35 21.637500000000003 28.725 27.8375 21.8 36-37 21.7375 28.075 28.3625 21.825 38-39 20.5875 28.6125 28.925 21.875 40-41 22.05 28.525 27.9125 21.512500000000003 42-43 21.4375 28.8625 27.8875 21.8125 44-45 21.2375 28.875 28.1875 21.7 46-47 21.712500000000002 28.462500000000002 27.9125 21.912499999999998 48-49 21.425 28.075 28.1875 22.3125 50-51 22.1 29.6875 27.1625 21.05 52-53 21.099999999999998 29.349999999999998 27.3625 22.1875 54-55 21.4 28.9875 28.15 21.462500000000002 56-57 22.6375 27.650000000000002 28.15 21.5625 58-59 21.987499999999997 28.325 28.6125 21.075 60-61 21.7875 27.8625 28.4125 21.9375 62-63 21.5375 28.3875 28.3125 21.762500000000003 64-65 21.8625 29.15 28.1 20.8875 66-67 21.95 28.3875 28.199999999999996 21.462500000000002 68-69 21.912499999999998 28.7375 28.375 20.974999999999998 70-71 22.2 28.599999999999998 28.299999999999997 20.9 72-73 20.9375 29.45 28.325 21.2875 74-75 22.05 29.125 27.9125 20.9125 76-77 21.4125 29.099999999999998 27.925 21.5625 78-79 22.05 28.712500000000002 27.400000000000002 21.837500000000002 80-81 21.2625 28.537499999999998 28.4 21.8 82-83 21.875 29.075 27.450000000000003 21.6 84-85 21.512500000000003 29.4 27.5125 21.575 86-87 22.175 28.3625 27.5875 21.875 88-89 21.987499999999997 28.000000000000004 28.787499999999998 21.224999999999998 90-91 21.1375 29.037499999999998 28.3375 21.4875 92-93 21.6875 28.487499999999997 28.7 21.125 94-95 21.4375 28.6875 28.212500000000002 21.6625 96-97 22.5625 27.762500000000003 28.7375 20.9375 98-99 21.8 28.787499999999998 28.599999999999998 20.8125 100 22.1 27.425 28.225 22.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.5 23 2.5 24 4.0 25 5.5 26 5.5 27 6.5 28 10.5 29 16.5 30 23.5 31 35.0 32 46.5 33 56.5 34 68.5 35 88.0 36 111.5 37 137.5 38 158.0 39 189.5 40 219.0 41 239.0 42 253.5 43 262.5 44 273.5 45 264.5 46 241.0 47 214.0 48 197.0 49 174.5 50 143.5 51 119.0 52 92.5 53 67.0 54 50.5 55 39.5 56 30.5 57 29.0 58 26.0 59 20.5 60 19.5 61 12.5 62 6.5 63 7.0 64 6.5 65 3.5 66 3.5 67 3.5 68 1.5 69 1.0 70 2.0 71 2.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGAGG 20 0.0020083564 70.5 7 >>END_MODULE Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727203 spots for SRR3241530.sra Written 727203 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra Read 727190 spots for SRR3241530.sra Written 727190 spots for SRR3241530.sra SRR ids: ['SRR3241530.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hmpoz15p SRR3241530.sra spots: 14543813 blocks: [[1, 727190], [727191, 1454380], [1454381, 2181570], [2181571, 2908760], [2908761, 3635950], [3635951, 4363140], [4363141, 5090330], [5090331, 5817520], [5817521, 6544710], [6544711, 7271900], [7271901, 7999090], [7999091, 8726280], [8726281, 9453470], [9453471, 10180660], [10180661, 10907850], [10907851, 11635040], [11635041, 12362230], [12362231, 13089420], [13089421, 13816610], [13816611, 14543813]] SRR3241530 file size 3788235 SRR3241530 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241530 SRR3241530_1.fastq Input file: SRR3241530_1.fastq trimmed: SRR3241530-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:28:00 2025 >> started Mon Feb 10 15:28:13 2025 >> done (12.638s) 14543813 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 14543813 (100.00%) reads available; of these: 597620 ( 4.11%) trimmed reads available after processing 13946193 (95.89%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 51 1365 0.01% 52 1798 0.01% 53 2377 0.02% 54 2731 0.02% 55 3118 0.02% 56 3414 0.02% 57 3596 0.02% 58 3930 0.03% 59 4067 0.03% 60 4299 0.03% 61 4371 0.03% 62 4382 0.03% 63 4681 0.03% 64 4690 0.03% 65 5123 0.04% 66 5106 0.04% 67 5457 0.04% 68 5462 0.04% 69 5616 0.04% 70 6026 0.04% 71 6106 0.04% 72 6547 0.05% 73 6728 0.05% 74 7273 0.05% 75 7469 0.05% 76 4560 0.03% 77 5330 0.04% 78 6142 0.04% 79 6652 0.05% 80 7110 0.05% 81 7522 0.05% 82 8231 0.06% 83 8645 0.06% 84 9340 0.06% 85 10139 0.07% 86 10573 0.07% 87 11639 0.08% 88 12950 0.09% 89 13769 0.09% 90 15222 0.10% 91 17227 0.12% 92 19532 0.13% 93 22965 0.16% 94 27648 0.19% 95 31800 0.22% 96 39020 0.27% 97 52001 0.36% 98 69541 0.48% 99 64330 0.44% 100 13946193 95.89% 14543813 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=177.53 fanout-score-rank=4 prefix-density=0.39 prefix-fanout=24.7 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=303.73 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=28.0 sequence=TTCTTCTTCTTT Started job on | Feb 10 15:28:42 Started mapping on | Feb 10 15:28:42 Finished on | Feb 10 15:29:02 Mapping speed, Million of reads per hour | 2617.89 Number of input reads | 14543813 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13818061 Uniquely mapped reads % | 95.01% Average mapped length | 99.25 Number of splices: Total | 3643088 Number of splices: Annotated (sjdb) | 3559492 Number of splices: GT/AG | 3578236 Number of splices: GC/AG | 53808 Number of splices: AT/AC | 3908 Number of splices: Non-canonical | 7136 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360309 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 286441 % of reads mapped to too many loci | 1.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 365443 365443 365443 N_multimapping 360309 360309 360309 N_noFeature 801671 7242943 7292343 N_ambiguous 140106 27744 28239 UnstrandedReadsAssigned:12876284 PositiveStrandReadsAssigned:6547374 NegativeStrandReadsAssigned:6497479 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241530 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241530-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,543,813 reads, 13,396,391 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52401 SRR3241530.ke.tsv 34699 SRR3241530.se.tsv 87100 total ==> SRR3241530.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 823 44.1499 Potri.005G024800.1.v4.1 1035 936 362 39.8141 Potri.004G059700.1.v4.1 961 862 10 1.19426 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 248.213 8.98462 Potri.016G087400.1.v4.1 270 171 322 193.849 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 59 3.62828 Potri.012G127500.1.v4.1 977 878 2574 301.8 ==> SRR3241530.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2057 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR3241530 completed mapping pipeline successfully