Starting /dee2/code/volunteer_pipeline.sh SRR3241531 current disk space = 3058576424960 free memory = 1019346712 SRR3241531 SRAfilesize d6c35f9e288b9bd258925b40ed5fb82f SRR3241531.sra SRR3241531.sra file validated SRR3241531 is single end SRR3241531 is conventional basespace SRR3241531 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241531_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0765 34.0 33.0 34.0 31.0 34.0 2 33.23 34.0 34.0 34.0 31.0 34.0 3 33.3575 34.0 34.0 34.0 31.0 34.0 4 36.61825 37.0 37.0 37.0 35.0 37.0 5 36.58075 37.0 37.0 37.0 35.0 37.0 6 36.46725 37.0 37.0 37.0 35.0 37.0 7 36.49725 37.0 37.0 37.0 35.0 37.0 8 36.50275 37.0 37.0 37.0 35.0 37.0 9 38.4285 39.0 39.0 39.0 37.0 39.0 10-11 38.370374999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.321 39.0 39.0 39.0 37.0 39.0 14-15 39.914125 41.0 40.0 41.0 38.0 41.0 16-17 39.95975 41.0 40.0 41.0 38.0 41.0 18-19 39.89675 41.0 40.0 41.0 38.0 41.0 20-21 39.834125 41.0 40.0 41.0 38.0 41.0 22-23 39.900375 41.0 40.0 41.0 38.0 41.0 24-25 39.9085 41.0 40.0 41.0 38.0 41.0 26-27 39.634625 41.0 40.0 41.0 37.5 41.0 28-29 39.654624999999996 41.0 40.0 41.0 37.5 41.0 30-31 39.360125 41.0 39.0 41.0 36.5 41.0 32-33 39.377125 41.0 39.0 41.0 37.0 41.0 34-35 39.313875 40.0 39.0 41.0 37.0 41.0 36-37 39.57275 41.0 39.5 41.0 37.5 41.0 38-39 39.486625000000004 41.0 40.0 41.0 37.0 41.0 40-41 39.638999999999996 41.0 40.0 41.0 37.0 41.0 42-43 39.756625 41.0 40.0 41.0 37.5 41.0 44-45 39.649375000000006 41.0 40.0 41.0 37.0 41.0 46-47 39.617625000000004 41.0 40.0 41.0 37.0 41.0 48-49 39.480125 41.0 39.5 41.0 37.0 41.0 50-51 39.338875 41.0 39.0 41.0 36.0 41.0 52-53 39.192 41.0 39.0 41.0 35.5 41.0 54-55 38.86175 40.0 38.5 41.0 35.0 41.0 56-57 38.679500000000004 40.0 38.0 41.0 34.5 41.0 58-59 38.763625 40.0 38.0 41.0 35.0 41.0 60-61 38.661375 40.0 38.0 41.0 35.0 41.0 62-63 38.408874999999995 40.0 37.0 41.0 35.0 41.0 64-65 38.146375 39.5 37.0 41.0 34.5 41.0 66-67 37.750875 39.0 36.0 41.0 34.0 41.0 68-69 37.475 39.0 36.0 40.5 34.0 41.0 70-71 37.014875 37.5 35.0 40.0 34.0 41.0 72-73 36.5495 37.0 35.0 39.0 34.0 41.0 74-75 36.0725 36.5 35.0 39.0 33.0 40.5 76-77 34.651624999999996 35.0 33.5 37.0 31.0 39.0 78-79 35.157875000000004 35.5 35.0 37.0 32.0 39.0 80-81 34.91775 35.0 35.0 37.0 32.5 39.0 82-83 34.63875 35.0 35.0 36.0 32.0 37.0 84-85 34.374625 35.0 35.0 36.0 32.0 37.0 86-87 34.05175 35.0 34.0 36.0 31.5 37.0 88-89 34.03375 35.0 34.0 35.0 32.0 36.0 90-91 33.8495 35.0 34.0 35.0 32.0 36.0 92-93 33.673249999999996 35.0 34.0 35.0 31.5 36.0 94-95 33.684875000000005 35.0 34.0 35.0 32.0 36.0 96-97 33.27075 35.0 34.0 35.0 31.0 35.0 98-99 33.170375 35.0 34.0 35.0 31.0 35.0 100 33.1215 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.17781381938008423 1101 2 -0.05622489959839072 1101 3 0.033081042117188986 1101 4 0.023324065492737134 1101 5 0.04935125115848393 1101 6 0.11383997528576373 1101 7 0.1722273710225508 1101 8 0.09334774997425654 1101 9 0.10323344660694289 1101 10-11 0.11713520749665918 1101 12-13 0.07783698898156644 1101 14-15 0.04318556276388108 1101 16-17 0.15932962619709912 1101 18-19 0.24147873545464194 1101 20-21 0.19723766862320957 1101 22-23 0.0830501493152127 1101 24-25 0.0989728143342603 1101 26-27 0.2976907630522092 1101 28-29 0.10603954278652594 1101 30-31 0.15799093811141773 1101 32-33 0.1567938420348085 1101 34-35 0.35239676655339025 1101 36-37 0.2330733189166878 1101 38-39 -0.17774945937595987 1101 40-41 0.0643600041190453 1101 42-43 0.17252342704149726 1101 44-45 0.20385387704664737 1101 46-47 0.17558696323757061 1101 48-49 0.292619194727628 1101 50-51 0.20144681289259125 1101 52-53 0.1803367315415514 1101 54-55 0.10964370301719839 1101 56-57 -0.06230048398722943 1101 58-59 0.06170837194933654 1101 60-61 0.1223354958294749 1101 62-63 0.021624961383999164 1101 64-65 -0.029219441870047547 1101 66-67 -0.05504067552260494 1101 68-69 0.32613788487282136 1101 70-71 0.45526979713726945 1101 72-73 0.2875347544022304 1101 74-75 0.19347904438265573 1101 76-77 0.18784110802182852 1101 78-79 0.3293301410771292 1101 80-81 0.3156600762022421 1101 82-83 0.4000231696014822 1101 84-85 0.36813922356090956 1101 86-87 0.4482545566882905 1101 88-89 0.25440222428174053 1101 90-91 0.371434455771805 1101 92-93 0.4119555143651539 1101 94-95 0.4789928946555406 1101 96-97 0.1768484193183042 1101 98-99 0.16534085058182058 1101 100 0.48270003089280067 1106 1 0.17781381938008423 1106 2 0.05622489959839072 1106 3 -0.033081042117188986 1106 4 -0.023324065492737134 1106 5 -0.04935125115847683 1106 6 -0.11383997528575662 1106 7 -0.1722273710225508 1106 8 -0.09334774997425654 1106 9 -0.10323344660693579 1106 10-11 -0.11713520749665207 1106 12-13 -0.07783698898157354 1106 14-15 -0.043185562763873975 1106 16-17 -0.15932962619709912 1106 18-19 -0.24147873545464194 1106 20-21 -0.19723766862320957 1106 22-23 -0.0830501493152127 1106 24-25 -0.0989728143342603 1106 26-27 -0.2976907630522092 1106 28-29 -0.10603954278653305 1106 30-31 -0.15799093811141773 1106 32-33 -0.1567938420348014 1106 34-35 -0.35239676655339736 1106 36-37 -0.23307331891669492 1106 38-39 0.17774945937596698 1106 40-41 -0.0643600041190382 1106 42-43 -0.17252342704149726 1106 44-45 -0.20385387704664737 1106 46-47 -0.1755869632375635 1106 48-49 -0.292619194727628 1106 50-51 -0.20144681289259125 1106 52-53 -0.1803367315415514 1106 54-55 -0.10964370301719839 1106 56-57 0.06230048398723653 1106 58-59 -0.06170837194933654 1106 60-61 -0.1223354958294749 1106 62-63 -0.021624961383999164 1106 64-65 0.02921944187004044 1106 66-67 0.05504067552260494 1106 68-69 -0.32613788487282136 1106 70-71 -0.45526979713726945 1106 72-73 -0.2875347544022233 1106 74-75 -0.19347904438265573 1106 76-77 -0.18784110802183562 1106 78-79 -0.3293301410771292 1106 80-81 -0.31566007620224923 1106 82-83 -0.4000231696014822 1106 84-85 -0.36813922356090956 1106 86-87 -0.4482545566882976 1106 88-89 -0.25440222428174053 1106 90-91 -0.371434455771805 1106 92-93 -0.4119555143651539 1106 94-95 -0.47899289465554773 1106 96-97 -0.1768484193182971 1106 98-99 -0.16534085058181347 1106 100 -0.4827000308928078 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 2.0 18 0.0 19 1.0 20 2.0 21 5.0 22 5.0 23 5.0 24 7.0 25 11.0 26 19.0 27 13.0 28 18.0 29 17.0 30 26.0 31 38.0 32 46.0 33 75.0 34 118.0 35 149.0 36 292.0 37 812.0 38 1833.0 39 505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.647798742138367 15.09433962264151 19.371069182389938 41.88679245283019 2 21.4 23.05 36.5 19.05 3 24.125 25.25 26.5 24.125 4 23.175 31.525 20.8 24.5 5 24.5 35.15 22.0 18.35 6 18.425 38.4 23.7 19.475 7 16.975 18.425 44.224999999999994 20.375 8 19.575 25.45 27.800000000000004 27.175 9 20.4 23.825 30.599999999999998 25.174999999999997 10-11 22.45 33.5 23.45 20.599999999999998 12-13 20.8 26.55 30.162499999999998 22.4875 14-15 21.25 28.0875 28.6875 21.975 16-17 21.0375 29.0875 27.725 22.15 18-19 20.7 28.675 28.7 21.925 20-21 21.375 29.1125 27.55 21.9625 22-23 21.5375 28.3375 27.737499999999997 22.3875 24-25 21.9 28.8375 27.8125 21.45 26-27 21.075 29.1625 28.0625 21.7 28-29 21.912499999999998 28.875 26.924999999999997 22.287499999999998 30-31 20.9875 29.062500000000004 28.262500000000003 21.6875 32-33 21.3625 29.025000000000002 27.500000000000004 22.112499999999997 34-35 21.7 29.549999999999997 27.3875 21.3625 36-37 21.9375 28.9375 26.950000000000003 22.175 38-39 21.3875 29.012500000000003 28.012500000000003 21.587500000000002 40-41 22.075 28.3625 27.737499999999997 21.825 42-43 21.65 30.012499999999996 27.5875 20.75 44-45 21.65 28.712500000000002 28.175 21.462500000000002 46-47 21.5625 29.012500000000003 27.6625 21.762500000000003 48-49 21.2 28.3375 28.749999999999996 21.712500000000002 50-51 21.0625 29.299999999999997 27.712500000000002 21.925 52-53 21.3 29.4125 28.65 20.6375 54-55 21.0125 29.037499999999998 28.975 20.974999999999998 56-57 20.5 29.6375 28.225 21.637500000000003 58-59 21.8625 28.799999999999997 28.4125 20.925 60-61 21.6125 28.125 29.049999999999997 21.212500000000002 62-63 21.4375 28.525 29.299999999999997 20.7375 64-65 21.25 29.312500000000004 28.5875 20.849999999999998 66-67 22.275 28.3375 28.375 21.0125 68-69 20.200000000000003 29.2375 28.499999999999996 22.0625 70-71 21.25 28.812500000000004 29.349999999999998 20.5875 72-73 21.9375 29.012500000000003 27.975 21.075 74-75 21.75 28.675 28.3625 21.212500000000002 76-77 21.7375 28.875 27.575 21.8125 78-79 22.3 29.262500000000003 26.950000000000003 21.4875 80-81 22.037499999999998 28.499999999999996 28.175 21.2875 82-83 22.125 28.1 28.3875 21.3875 84-85 21.8125 29.1125 28.3375 20.7375 86-87 21.912499999999998 28.549999999999997 28.4 21.1375 88-89 21.8875 28.537499999999998 28.4125 21.1625 90-91 21.115139392424055 28.92861607700963 28.528566070758842 21.427678459807474 92-93 21.1875 29.4125 28.050000000000004 21.349999999999998 94-95 20.4375 29.1625 28.7 21.7 96-97 21.702712839104887 28.55356919614952 29.103637954744343 20.64008001000125 98-99 21.987499999999997 30.025000000000002 27.4125 20.575 100 21.075 28.075 29.575000000000003 21.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 5.5 26 9.5 27 11.0 28 13.5 29 18.5 30 30.0 31 43.5 32 58.0 33 67.0 34 78.0 35 98.5 36 114.0 37 128.0 38 153.0 39 176.0 40 197.0 41 225.0 42 257.5 43 256.5 44 237.5 45 254.0 46 262.5 47 228.5 48 186.5 49 177.5 50 153.5 51 122.0 52 105.5 53 77.5 54 62.5 55 50.0 56 31.5 57 22.0 58 16.0 59 14.0 60 11.0 61 9.0 62 8.5 63 4.5 64 3.5 65 4.0 66 3.5 67 1.5 68 3.5 69 3.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0125 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670863 spots for SRR3241531.sra Written 670863 spots for SRR3241531.sra Read 670868 spots for SRR3241531.sra Written 670868 spots for SRR3241531.sra SRR ids: ['SRR3241531.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k9fiyx1_ SRR3241531.sra spots: 13417265 blocks: [[1, 670863], [670864, 1341726], [1341727, 2012589], [2012590, 2683452], [2683453, 3354315], [3354316, 4025178], [4025179, 4696041], [4696042, 5366904], [5366905, 6037767], [6037768, 6708630], [6708631, 7379493], [7379494, 8050356], [8050357, 8721219], [8721220, 9392082], [9392083, 10062945], [10062946, 10733808], [10733809, 11404671], [11404672, 12075534], [12075535, 12746397], [12746398, 13417265]] SRR3241531 file size 3493951 SRR3241531 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241531 SRR3241531_1.fastq Input file: SRR3241531_1.fastq trimmed: SRR3241531-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:58:27 2025 >> started Mon Feb 10 15:58:37 2025 >> done (9.815s) 13417265 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 13417265 (100.00%) reads available; of these: 525702 ( 3.92%) trimmed reads available after processing 12891563 (96.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 48 1 0.00% 49 2 0.00% 50 0 0.00% 51 1119 0.01% 52 1607 0.01% 53 2017 0.02% 54 2409 0.02% 55 2775 0.02% 56 3022 0.02% 57 3037 0.02% 58 3408 0.03% 59 3542 0.03% 60 3774 0.03% 61 3705 0.03% 62 3894 0.03% 63 3949 0.03% 64 4033 0.03% 65 4169 0.03% 66 4419 0.03% 67 4625 0.03% 68 4634 0.03% 69 5038 0.04% 70 5125 0.04% 71 5363 0.04% 72 5766 0.04% 73 5927 0.04% 74 6247 0.05% 75 6665 0.05% 76 4043 0.03% 77 4711 0.04% 78 5265 0.04% 79 5813 0.04% 80 6178 0.05% 81 6681 0.05% 82 7058 0.05% 83 7614 0.06% 84 8079 0.06% 85 8820 0.07% 86 9458 0.07% 87 9954 0.07% 88 11268 0.08% 89 11937 0.09% 90 13259 0.10% 91 15365 0.11% 92 17300 0.13% 93 20165 0.15% 94 24451 0.18% 95 28019 0.21% 96 34413 0.26% 97 46162 0.34% 98 62286 0.46% 99 57131 0.43% 100 12891563 96.08% 13417265 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=30 prefix-density=0.08 prefix-fanout=3.6 sequence=CAAGGTGGGTACAACCAACAAGAGCACAGGGGCGGCGCACAAGGTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=273.69 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=26.5 sequence=CTTCTTCTTCTC Started job on | Feb 10 15:58:56 Started mapping on | Feb 10 15:58:56 Finished on | Feb 10 15:59:12 Mapping speed, Million of reads per hour | 3018.88 Number of input reads | 13417265 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12872114 Uniquely mapped reads % | 95.94% Average mapped length | 99.24 Number of splices: Total | 3323335 Number of splices: Annotated (sjdb) | 3245975 Number of splices: GT/AG | 3268983 Number of splices: GC/AG | 44262 Number of splices: AT/AC | 3217 Number of splices: Non-canonical | 6873 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.03 Insertion rate per base | 0.02% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 377112 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 98138 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 168039 168039 168039 N_multimapping 377112 377112 377112 N_noFeature 625512 6652815 6743925 N_ambiguous 147860 23622 23784 UnstrandedReadsAssigned:12098742 PositiveStrandReadsAssigned:6195677 NegativeStrandReadsAssigned:6104405 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241531 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241531-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,417,265 reads, 12,473,293 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52401 SRR3241531.ke.tsv 34699 SRR3241531.se.tsv 87100 total ==> SRR3241531.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1668 88.1211 Potri.005G024800.1.v4.1 1035 936 12530 1357.17 Potri.004G059700.1.v4.1 961 862 6 0.705672 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 353.713 12.609 Potri.016G087400.1.v4.1 270 171 385 228.257 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 138.668 8.39805 Potri.012G127500.1.v4.1 977 878 702 81.059 ==> SRR3241531.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 299 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 21 SRR3241531 completed mapping pipeline successfully