Starting /dee2/code/volunteer_pipeline.sh SRR3241532 current disk space = 3059000078336 free memory = 873846772 SRR3241532 SRAfilesize 1a054da19a53d9732f389ae21a1b47f5 SRR3241532.sra SRR3241532.sra file validated SRR3241532 is single end SRR3241532 is conventional basespace SRR3241532 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241532_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98075 34.0 33.0 34.0 31.0 34.0 2 33.21725 34.0 34.0 34.0 31.0 34.0 3 33.3535 34.0 34.0 34.0 31.0 34.0 4 36.61875 37.0 37.0 37.0 35.0 37.0 5 36.589 37.0 37.0 37.0 35.0 37.0 6 36.5505 37.0 37.0 37.0 35.0 37.0 7 36.52525 37.0 37.0 37.0 35.0 37.0 8 36.52625 37.0 37.0 37.0 35.0 37.0 9 38.40025 39.0 39.0 39.0 37.0 39.0 10-11 38.42225 39.0 39.0 39.0 37.0 39.0 12-13 38.310875 39.0 39.0 39.0 37.0 39.0 14-15 39.963375 41.0 40.0 41.0 38.0 41.0 16-17 39.954125000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.790125 41.0 40.0 41.0 38.0 41.0 20-21 39.858125 41.0 40.0 41.0 38.0 41.0 22-23 39.684875 41.0 40.0 41.0 37.0 41.0 24-25 39.75675 41.0 40.0 41.0 38.0 41.0 26-27 39.568625 41.0 40.0 41.0 37.0 41.0 28-29 39.543499999999995 41.0 40.0 41.0 37.0 41.0 30-31 39.470749999999995 41.0 39.0 41.0 37.0 41.0 32-33 39.286375 41.0 39.0 41.0 36.0 41.0 34-35 39.25975 40.0 39.0 41.0 36.0 41.0 36-37 39.439750000000004 41.0 39.0 41.0 37.0 41.0 38-39 39.327 41.0 39.0 41.0 36.0 41.0 40-41 39.56325 41.0 40.0 41.0 37.0 41.0 42-43 39.611875 41.0 40.0 41.0 37.0 41.0 44-45 39.541250000000005 41.0 40.0 41.0 37.0 41.0 46-47 39.513374999999996 41.0 40.0 41.0 37.0 41.0 48-49 39.424375 41.0 39.0 41.0 36.0 41.0 50-51 39.345749999999995 41.0 39.0 41.0 36.0 41.0 52-53 39.183 41.0 39.0 41.0 35.0 41.0 54-55 38.814625 40.0 39.0 41.0 35.0 41.0 56-57 38.560125 40.0 38.0 41.0 34.0 41.0 58-59 38.7105 40.0 38.0 41.0 35.0 41.0 60-61 38.622875 40.0 38.0 41.0 35.0 41.0 62-63 38.2765 40.0 37.0 41.0 34.5 41.0 64-65 37.979875 39.0 37.0 41.0 34.0 41.0 66-67 37.6035 39.0 36.0 41.0 34.0 41.0 68-69 37.35275 39.0 35.5 40.5 34.0 41.0 70-71 37.060125 37.5 35.0 40.0 34.0 41.0 72-73 36.54675 37.0 35.0 39.0 33.5 41.0 74-75 36.0105 36.5 35.0 39.0 33.0 40.5 76-77 34.636375 35.0 33.5 37.0 30.5 39.0 78-79 35.180499999999995 35.5 34.5 37.0 32.5 39.0 80-81 34.946 35.0 35.0 37.0 32.0 39.0 82-83 34.662000000000006 35.0 35.0 36.0 32.5 37.0 84-85 34.33225 35.0 34.5 36.0 32.0 37.0 86-87 34.150625000000005 35.0 34.5 36.0 32.0 37.0 88-89 34.068250000000006 35.0 34.5 35.0 32.0 36.0 90-91 33.948125000000005 35.0 34.0 35.0 32.0 36.0 92-93 33.79325 35.0 34.0 35.0 32.0 36.0 94-95 33.707499999999996 35.0 34.0 35.0 32.0 36.0 96-97 33.266625000000005 35.0 34.0 35.0 31.0 35.0 98-99 33.15775 35.0 34.0 35.0 31.0 35.0 100 33.11425 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.14062658936018835 1101 2 -0.14159292035398607 1101 3 -0.1443139049944051 1101 4 -0.060599125216150185 1101 5 -0.016605635235478644 1101 6 -0.09462414810293751 1101 7 0.021513579493444013 1101 8 -0.004373919235071355 1101 9 0.032372088292135004 1101 10-11 0.04234055538601922 1101 12-13 -0.1779193367917813 1101 14-15 0.07555182585698361 1101 16-17 0.12976808056149025 1101 18-19 0.17774132845081425 1101 20-21 -0.05388566778557902 1101 22-23 0.009383582545012814 1101 24-25 0.06348540331603658 1101 26-27 0.033160410944972796 1101 28-29 0.004399348998070707 1101 30-31 0.11953260095615548 1101 32-33 0.01045163259078663 1101 34-35 0.0528176177398052 1101 36-37 0.04022988505747094 1101 38-39 -0.343403519479196 1101 40-41 -0.042772861356930036 1101 42-43 0.0534025022886766 1101 44-45 0.062213915166310585 1101 46-47 0.058018004272199164 1101 48-49 0.2508773268233142 1101 50-51 0.08332061845183603 1101 52-53 -0.14992116773471764 1101 54-55 -0.42173990438409703 1101 56-57 -0.18848540331603658 1101 58-59 0.23067338012410232 1101 60-61 0.3437976808056149 1101 62-63 -0.021208422337508637 1101 64-65 0.3238861763808387 1101 66-67 0.18669260502492335 1101 68-69 0.5659266605635267 1101 70-71 0.38847777438714104 1101 72-73 0.20983368935001323 1101 74-75 0.0620613365883429 1101 76-77 0.26861458651205083 1101 78-79 0.11896043128878375 1101 80-81 -0.05421625470450664 1101 82-83 0.2608076492727136 1101 84-85 0.07333943647644503 1101 86-87 0.1825602685382961 1101 88-89 0.11659546333027748 1101 90-91 -0.015715593530664762 1101 92-93 0.08034533618146611 1101 94-95 -0.0620104770623513 1101 96-97 -0.3826289288983844 1101 98-99 -0.16877733699521968 1101 100 0.10965313803275478 1104 1 0.14062658936018835 1104 2 0.14159292035397897 1104 3 0.1443139049944051 1104 4 0.06059912521615729 1104 5 0.016605635235478644 1104 6 0.09462414810294462 1104 7 -0.021513579493436907 1104 8 0.004373919235071355 1104 9 -0.03237208829214211 1104 10-11 -0.042340555386026324 1104 12-13 0.1779193367917813 1104 14-15 -0.07555182585698361 1104 16-17 -0.12976808056149025 1104 18-19 -0.17774132845082136 1104 20-21 0.05388566778557902 1104 22-23 -0.009383582545005709 1104 24-25 -0.06348540331603658 1104 26-27 -0.033160410944972796 1104 28-29 -0.004399348998070707 1104 30-31 -0.11953260095616258 1104 32-33 -0.01045163259078663 1104 34-35 -0.052817617739798095 1104 36-37 -0.04022988505747094 1104 38-39 0.3434035194792031 1104 40-41 0.042772861356930036 1104 42-43 -0.0534025022886766 1104 44-45 -0.062213915166310585 1104 46-47 -0.058018004272199164 1104 48-49 -0.2508773268233142 1104 50-51 -0.08332061845184313 1104 52-53 0.14992116773471764 1104 54-55 0.4217399043840899 1104 56-57 0.1884854033160437 1104 58-59 -0.23067338012409522 1104 60-61 -0.3437976808056149 1104 62-63 0.02120842233750153 1104 64-65 -0.3238861763808387 1104 66-67 -0.18669260502491625 1104 68-69 -0.5659266605635196 1104 70-71 -0.38847777438714104 1104 72-73 -0.20983368935002034 1104 74-75 -0.0620613365883429 1104 76-77 -0.26861458651205083 1104 78-79 -0.11896043128878375 1104 80-81 0.05421625470450664 1104 82-83 -0.2608076492727065 1104 84-85 -0.07333943647645214 1104 86-87 -0.1825602685382961 1104 88-89 -0.11659546333027748 1104 90-91 0.015715593530664762 1104 92-93 -0.08034533618146611 1104 94-95 0.0620104770623513 1104 96-97 0.3826289288983844 1104 98-99 0.16877733699521968 1104 100 -0.10965313803275478 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 2.0 19 3.0 20 5.0 21 10.0 22 2.0 23 1.0 24 9.0 25 13.0 26 10.0 27 14.0 28 21.0 29 25.0 30 34.0 31 34.0 32 42.0 33 65.0 34 101.0 35 152.0 36 333.0 37 813.0 38 1793.0 39 516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.46861608268213 15.402067053188809 18.099319384925636 43.02999747920343 2 19.05 23.1 37.625 20.225 3 22.2 26.450000000000003 27.650000000000002 23.7 4 24.075 31.874999999999996 21.05 23.0 5 25.3 33.15 23.375 18.175 6 19.8 37.5 23.200000000000003 19.5 7 16.125 18.775 44.824999999999996 20.275000000000002 8 18.725 24.05 30.975 26.25 9 19.975 23.325000000000003 32.15 24.55 10-11 21.8 33.887499999999996 23.125 21.1875 12-13 19.875 27.375 30.075000000000003 22.675 14-15 20.8625 28.525 29.625 20.9875 16-17 22.125 29.075 27.125 21.675 18-19 21.1625 28.462500000000002 28.3875 21.987499999999997 20-21 22.6875 28.962500000000002 27.1125 21.2375 22-23 21.15 29.15 28.0875 21.6125 24-25 21.65 29.125 27.0125 22.2125 26-27 20.3375 29.6375 28.462500000000002 21.5625 28-29 22.225 27.5125 29.1875 21.075 30-31 21.0125 29.1125 28.6625 21.212500000000002 32-33 21.337500000000002 29.012500000000003 28.225 21.425 34-35 21.837500000000002 28.8375 27.85 21.475 36-37 21.45 29.212500000000002 27.775 21.5625 38-39 22.5875 28.462500000000002 27.5875 21.3625 40-41 20.575 29.549999999999997 27.950000000000003 21.925 42-43 21.0375 28.8625 28.8625 21.2375 44-45 20.9 29.1375 28.3875 21.575 46-47 21.587500000000002 29.062500000000004 28.3125 21.0375 48-49 20.775 28.625 28.299999999999997 22.3 50-51 21.912499999999998 29.325000000000003 27.487499999999997 21.275 52-53 21.8875 29.1375 27.487499999999997 21.4875 54-55 21.9375 29.15 28.5625 20.349999999999998 56-57 21.55 28.225 28.4 21.825 58-59 21.1375 29.25 28.237499999999997 21.375 60-61 21.0375 28.3375 28.787499999999998 21.837500000000002 62-63 21.6625 29.012500000000003 27.6375 21.6875 64-65 20.8625 28.599999999999998 29.025000000000002 21.512500000000003 66-67 21.6625 27.9375 28.075 22.325 68-69 21.0125 29.4 28.025 21.5625 70-71 21.4 28.599999999999998 29.15 20.849999999999998 72-73 22.650000000000002 28.000000000000004 28.025 21.325 74-75 21.7375 29.2 28.199999999999996 20.8625 76-77 21.625 28.4375 27.962500000000002 21.975 78-79 21.512500000000003 28.349999999999998 29.062500000000004 21.075 80-81 21.8 28.375 28.749999999999996 21.075 82-83 20.7875 29.775000000000002 28.037499999999998 21.4 84-85 21.2375 27.800000000000004 29.675 21.2875 86-87 21.875 28.9 28.812500000000004 20.4125 88-89 21.55 29.1625 28.199999999999996 21.087500000000002 90-91 21.2375 28.825 28.525 21.4125 92-93 21.5 29.0875 28.712500000000002 20.7 94-95 22.0625 28.262500000000003 28.799999999999997 20.875 96-97 22.112499999999997 27.625 28.012500000000003 22.25 98-99 20.5875 29.45 29.062500000000004 20.9 100 20.45 30.099999999999998 27.925 21.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 3.0 23 3.0 24 1.5 25 3.5 26 7.5 27 8.5 28 12.5 29 23.5 30 30.5 31 43.5 32 54.0 33 67.5 34 89.0 35 108.0 36 124.5 37 142.0 38 164.5 39 183.0 40 199.0 41 219.5 42 236.0 43 252.5 44 260.5 45 247.5 46 231.5 47 220.5 48 203.0 49 161.5 50 132.5 51 121.0 52 96.0 53 70.0 54 59.0 55 45.5 56 36.5 57 35.0 58 23.0 59 14.0 60 14.5 61 12.0 62 5.5 63 5.5 64 5.0 65 5.5 66 5.0 67 1.5 68 2.5 69 3.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACAT 25 0.0048637707 56.4 1 >>END_MODULE Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974061 spots for SRR3241532.sra Written 974061 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra Read 974059 spots for SRR3241532.sra Written 974059 spots for SRR3241532.sra SRR ids: ['SRR3241532.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2nr2ad7n SRR3241532.sra spots: 19481182 blocks: [[1, 974059], [974060, 1948118], [1948119, 2922177], [2922178, 3896236], [3896237, 4870295], [4870296, 5844354], [5844355, 6818413], [6818414, 7792472], [7792473, 8766531], [8766532, 9740590], [9740591, 10714649], [10714650, 11688708], [11688709, 12662767], [12662768, 13636826], [13636827, 14610885], [14610886, 15584944], [15584945, 16559003], [16559004, 17533062], [17533063, 18507121], [18507122, 19481182]] SRR3241532 file size 5077954 SRR3241532 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241532 SRR3241532_1.fastq Input file: SRR3241532_1.fastq trimmed: SRR3241532-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:36:27 2025 >> started Mon Feb 10 15:36:36 2025 >> done (9.673s) 19481182 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 19481182 (100.00%) reads available; of these: 780681 ( 4.01%) trimmed reads available after processing 18700501 (95.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 51 1639 0.01% 52 2448 0.01% 53 3031 0.02% 54 3669 0.02% 55 4048 0.02% 56 4473 0.02% 57 4848 0.02% 58 5044 0.03% 59 5529 0.03% 60 5632 0.03% 61 5689 0.03% 62 5860 0.03% 63 5851 0.03% 64 6079 0.03% 65 6404 0.03% 66 6660 0.03% 67 6991 0.04% 68 7172 0.04% 69 7348 0.04% 70 7937 0.04% 71 8074 0.04% 72 8396 0.04% 73 9044 0.05% 74 9283 0.05% 75 9950 0.05% 76 6076 0.03% 77 7177 0.04% 78 7946 0.04% 79 8790 0.05% 80 9339 0.05% 81 10070 0.05% 82 10679 0.05% 83 11244 0.06% 84 12222 0.06% 85 13269 0.07% 86 14057 0.07% 87 14839 0.08% 88 16597 0.09% 89 17965 0.09% 90 19733 0.10% 91 22591 0.12% 92 25305 0.13% 93 29757 0.15% 94 36265 0.19% 95 41641 0.21% 96 51011 0.26% 97 67858 0.35% 98 91118 0.47% 99 84033 0.43% 100 18700501 95.99% 19481182 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=33 prefix-density=0.09 prefix-fanout=3.0 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=259.67 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=27.5 sequence=TTCTTCTTCTTTT Started job on | Feb 10 15:36:52 Started mapping on | Feb 10 15:36:52 Finished on | Feb 10 15:37:09 Mapping speed, Million of reads per hour | 4125.43 Number of input reads | 19481182 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 18690464 Uniquely mapped reads % | 95.94% Average mapped length | 99.24 Number of splices: Total | 4730451 Number of splices: Annotated (sjdb) | 4622926 Number of splices: GT/AG | 4653301 Number of splices: GC/AG | 62172 Number of splices: AT/AC | 4840 Number of splices: Non-canonical | 10138 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.02% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 558234 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 129050 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 232484 232484 232484 N_multimapping 558234 558234 558234 N_noFeature 920378 9677694 9785729 N_ambiguous 220463 36864 36858 UnstrandedReadsAssigned:17549623 PositiveStrandReadsAssigned:8975906 NegativeStrandReadsAssigned:8867877 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241532 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241532-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,481,182 reads, 18,106,153 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,279 rounds 52401 SRR3241532.ke.tsv 34699 SRR3241532.se.tsv 87100 total ==> SRR3241532.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 3266 119.161 Potri.005G024800.1.v4.1 1035 936 6785 507.534 Potri.004G059700.1.v4.1 961 862 71 5.7669 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 514.535 12.6671 Potri.016G087400.1.v4.1 270 171 621 254.265 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 131 5.47908 Potri.012G127500.1.v4.1 977 878 569 45.3742 ==> SRR3241532.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 476 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 468 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 25 SRR3241532 completed mapping pipeline successfully