Starting /dee2/code/volunteer_pipeline.sh SRR3241533 current disk space = 3058703155200 free memory = 1242346692 SRR3241533 SRAfilesize 238428e2df19e775d6953f722f3ef102 SRR3241533.sra SRR3241533.sra file validated SRR3241533 is single end SRR3241533 is conventional basespace SRR3241533 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241533_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.953 34.0 33.0 34.0 31.0 34.0 2 33.14675 34.0 34.0 34.0 31.0 34.0 3 33.23 34.0 34.0 34.0 31.0 34.0 4 36.4535 37.0 37.0 37.0 35.0 37.0 5 36.54125 37.0 37.0 37.0 35.0 37.0 6 36.518 37.0 37.0 37.0 35.0 37.0 7 36.51425 37.0 37.0 37.0 35.0 37.0 8 36.464 37.0 37.0 37.0 35.0 37.0 9 38.39225 39.0 39.0 39.0 37.0 39.0 10-11 38.360875 39.0 39.0 39.0 37.0 39.0 12-13 38.28125 39.0 39.0 39.0 37.0 39.0 14-15 39.897625000000005 41.0 40.0 41.0 38.0 41.0 16-17 39.809875000000005 41.0 40.0 41.0 37.5 41.0 18-19 39.848 41.0 40.0 41.0 38.0 41.0 20-21 39.78825 41.0 40.0 41.0 38.0 41.0 22-23 39.816125 41.0 40.0 41.0 38.0 41.0 24-25 39.7285 41.0 40.0 41.0 37.0 41.0 26-27 39.612375 41.0 40.0 41.0 37.0 41.0 28-29 39.614374999999995 41.0 40.0 41.0 37.0 41.0 30-31 39.6115 41.0 40.0 41.0 37.0 41.0 32-33 39.386875 41.0 39.0 41.0 36.5 41.0 34-35 39.378 41.0 39.0 41.0 36.0 41.0 36-37 39.49725 41.0 39.0 41.0 37.0 41.0 38-39 39.272125 41.0 39.5 41.0 36.0 41.0 40-41 39.498375 41.0 40.0 41.0 37.0 41.0 42-43 39.614125 41.0 40.0 41.0 37.0 41.0 44-45 39.491125 41.0 40.0 41.0 37.0 41.0 46-47 39.44725 41.0 40.0 41.0 36.0 41.0 48-49 39.473625 41.0 40.0 41.0 37.0 41.0 50-51 39.365625 41.0 39.0 41.0 36.0 41.0 52-53 39.165625000000006 41.0 39.0 41.0 35.0 41.0 54-55 38.80025 40.0 39.0 41.0 35.0 41.0 56-57 38.7225 40.0 38.0 41.0 35.0 41.0 58-59 38.718375 40.0 38.0 41.0 35.0 41.0 60-61 38.55675 40.0 38.0 41.0 35.0 41.0 62-63 38.266000000000005 40.0 37.0 41.0 34.5 41.0 64-65 37.998875 39.0 37.0 41.0 34.0 41.0 66-67 37.572 39.0 36.0 41.0 34.0 41.0 68-69 37.37025 39.0 36.0 40.5 34.0 41.0 70-71 36.8785 37.5 35.0 40.0 33.5 41.0 72-73 36.338875 37.0 35.0 39.0 33.0 41.0 74-75 35.955125 36.5 35.0 39.0 32.5 40.5 76-77 34.600125 35.0 34.0 37.0 30.5 39.0 78-79 35.045125 36.0 35.0 37.0 32.0 39.0 80-81 34.81125 35.0 35.0 37.0 32.0 39.0 82-83 34.49625 35.0 35.0 36.0 32.0 37.0 84-85 34.299375 35.0 35.0 36.0 32.0 37.0 86-87 34.04774999999999 35.0 35.0 36.0 32.0 37.0 88-89 33.844 35.0 34.0 35.0 31.5 36.0 90-91 33.679 35.0 34.0 35.0 31.0 36.0 92-93 33.54875 35.0 34.0 35.0 31.0 36.0 94-95 33.498125 35.0 34.0 35.0 31.5 36.0 96-97 32.9805 35.0 34.0 35.0 30.0 35.0 98-99 32.901375 35.0 34.0 35.0 30.5 35.0 100 32.733 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.3166564667482632 1101 2 -0.2435230518155862 1101 3 -0.03748470012239835 1101 4 -0.06405548755609658 1101 5 -0.06119951040391669 1101 6 -0.018308853529177327 1101 7 -0.07175642594859255 1101 8 0.00887392900856554 1101 9 -0.17105263157894512 1101 10-11 -0.12466850265197849 1101 12-13 -0.12477050183598237 1101 14-15 -0.04212566299469955 1101 16-17 0.02708078335373898 1101 18-19 0.034985720114242724 1101 20-21 0.03312423500612027 1101 22-23 -0.125 1101 24-25 -0.022822317421457683 1101 26-27 -0.1434108527131741 1101 28-29 -0.11821705426356743 1101 30-31 -0.11046511627906597 1101 32-33 -0.08771929824561653 1101 34-35 -0.01249490004079945 1101 36-37 -0.1662841697266373 1101 38-39 -0.8264738882088949 1101 40-41 -0.3559516523867785 1101 42-43 -0.20754283965728604 1101 44-45 -0.2913351693186428 1101 46-47 -0.11398408812729599 1101 48-49 -0.11671256629946924 1101 50-51 -0.2663963688290565 1101 52-53 -0.27549979600163255 1101 54-55 -0.41177070583435693 1101 56-57 -0.5822368421052602 1101 58-59 -0.4400499796001611 1101 60-61 -0.42301611587107146 1101 62-63 -0.5582670338637286 1101 64-65 -0.3224959200326367 1101 66-67 -0.2601999184006516 1101 68-69 -0.23079865361076912 1101 70-71 -0.18984598123214624 1101 72-73 0.001402488780094302 1101 74-75 -0.277641778865771 1101 76-77 -0.09593023255813904 1101 78-79 -0.27713178294573737 1101 80-81 -0.4716187270501848 1101 82-83 -0.18428702570378874 1101 84-85 -0.28817319461444413 1101 86-87 -0.40006629946960715 1101 88-89 -0.5057119543043669 1101 90-91 -0.4706242350061203 1101 92-93 -0.6256119951040375 1101 94-95 -0.7228682170542626 1101 96-97 -0.8975163198694425 1101 98-99 -0.6613117095063252 1101 100 -0.6290799673602585 1105 1 0.3166564667482703 1105 2 0.2435230518155862 1105 3 0.03748470012239835 1105 4 0.06405548755610369 1105 5 0.06119951040391669 1105 6 0.01830885352917022 1105 7 0.07175642594859255 1105 8 -0.008873929008572645 1105 9 0.17105263157895223 1105 10-11 0.12466850265197849 1105 12-13 0.12477050183598237 1105 14-15 0.04212566299469245 1105 16-17 -0.027080783353731874 1105 18-19 -0.03498572011423562 1105 20-21 -0.03312423500612027 1105 22-23 0.125 1105 24-25 0.02282231742146479 1105 26-27 0.1434108527131741 1105 28-29 0.11821705426356743 1105 30-31 0.11046511627907307 1105 32-33 0.08771929824560942 1105 34-35 0.012494900040792345 1105 36-37 0.1662841697266444 1105 38-39 0.8264738882088949 1105 40-41 0.3559516523867785 1105 42-43 0.20754283965727893 1105 44-45 0.2913351693186499 1105 46-47 0.11398408812729599 1105 48-49 0.11671256629946924 1105 50-51 0.2663963688290494 1105 52-53 0.27549979600163255 1105 54-55 0.41177070583435693 1105 56-57 0.5822368421052673 1105 58-59 0.4400499796001611 1105 60-61 0.42301611587107146 1105 62-63 0.5582670338637286 1105 64-65 0.3224959200326367 1105 66-67 0.2601999184006516 1105 68-69 0.23079865361076912 1105 70-71 0.18984598123214624 1105 72-73 -0.0014024887800871966 1105 74-75 0.277641778865771 1105 76-77 0.09593023255813904 1105 78-79 0.27713178294573027 1105 80-81 0.4716187270501848 1105 82-83 0.18428702570379585 1105 84-85 0.28817319461444413 1105 86-87 0.40006629946960715 1105 88-89 0.5057119543043669 1105 90-91 0.4706242350061203 1105 92-93 0.6256119951040446 1105 94-95 0.7228682170542697 1105 96-97 0.8975163198694389 1105 98-99 0.6613117095063217 1105 100 0.6290799673602621 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 3.0 19 8.0 20 2.0 21 6.0 22 8.0 23 12.0 24 9.0 25 7.0 26 14.0 27 18.0 28 21.0 29 25.0 30 19.0 31 36.0 32 55.0 33 87.0 34 114.0 35 136.0 36 287.0 37 765.0 38 1868.0 39 498.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.039354187689202 16.271442986881937 16.473259334006055 46.215943491422806 2 19.925 23.400000000000002 38.574999999999996 18.099999999999998 3 21.425 26.8 26.8 24.975 4 23.95 32.324999999999996 21.224999999999998 22.5 5 24.775 34.599999999999994 23.225 17.4 6 19.025 38.3 24.2 18.475 7 16.7 19.125 44.6 19.575 8 18.099999999999998 23.925 31.075000000000003 26.900000000000002 9 20.5 25.5 31.35 22.650000000000002 10-11 22.112499999999997 34.1625 23.4625 20.2625 12-13 19.9375 27.9125 30.099999999999998 22.05 14-15 21.65 28.9125 28.125 21.3125 16-17 21.775 28.4 28.712500000000002 21.1125 18-19 22.3 29.325000000000003 27.5625 20.8125 20-21 22.25 28.4 27.700000000000003 21.65 22-23 21.0625 28.9125 28.8625 21.1625 24-25 21.025 29.262500000000003 28.0875 21.625 26-27 21.125 29.225 28.625 21.025 28-29 21.925 28.199999999999996 27.787499999999998 22.0875 30-31 21.099999999999998 29.312500000000004 28.212500000000002 21.375 32-33 21.1125 29.6625 28.6625 20.5625 34-35 20.9 29.575000000000003 28.037499999999998 21.4875 36-37 21.712500000000002 29.349999999999998 27.737499999999997 21.2 38-39 21.475 29.25 28.000000000000004 21.275 40-41 21.475 29.262500000000003 28.050000000000004 21.212500000000002 42-43 21.2375 28.6375 29.012500000000003 21.1125 44-45 21.7875 29.212500000000002 27.625 21.375 46-47 21.425 29.675 27.650000000000002 21.25 48-49 21.75 29.462500000000002 28.262500000000003 20.525 50-51 20.7125 29.525000000000002 28.050000000000004 21.712500000000002 52-53 20.7125 28.749999999999996 29.612500000000004 20.925 54-55 21.9 27.987499999999997 28.65 21.462500000000002 56-57 22.3375 27.950000000000003 28.875 20.837500000000002 58-59 21.912499999999998 28.537499999999998 28.775000000000002 20.775 60-61 21.2625 28.3625 28.3875 21.987499999999997 62-63 20.9375 29.2 29.1625 20.7 64-65 20.8 29.912499999999998 27.625 21.6625 66-67 21.95 29.1625 28.575 20.3125 68-69 21.6 28.749999999999996 28.725 20.925 70-71 21.65 29.349999999999998 28.0625 20.9375 72-73 20.7875 29.6375 28.462500000000002 21.1125 74-75 21.675 29.075 28.299999999999997 20.95 76-77 21.6125 28.512500000000003 28.8625 21.0125 78-79 21.8625 28.287499999999998 28.375 21.475 80-81 21.587500000000002 28.975 28.825 20.6125 82-83 22.237499999999997 28.349999999999998 28.7375 20.674999999999997 84-85 21.8 29.099999999999998 28.6375 20.4625 86-87 21.4 28.512500000000003 29.0875 21.0 88-89 21.3625 29.912499999999998 27.55 21.175 90-91 21.25 29.512500000000003 28.375 20.8625 92-93 20.974999999999998 28.9125 29.1125 21.0 94-95 21.5625 28.875 29.262500000000003 20.3 96-97 21.275 28.9875 28.8375 20.9 98-99 21.775 28.262500000000003 28.549999999999997 21.4125 100 22.1 28.749999999999996 28.275 20.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.5 23 4.5 24 5.5 25 6.0 26 5.5 27 6.5 28 17.5 29 24.5 30 27.5 31 41.5 32 53.5 33 66.0 34 77.0 35 102.5 36 126.0 37 153.0 38 181.5 39 191.5 40 213.5 41 226.5 42 259.0 43 274.5 44 248.5 45 241.0 46 232.5 47 223.5 48 201.5 49 168.0 50 137.5 51 109.0 52 89.0 53 60.0 54 50.0 55 51.5 56 32.0 57 17.0 58 13.0 59 12.5 60 10.5 61 7.0 62 7.0 63 6.0 64 5.0 65 3.0 66 2.0 67 1.0 68 0.5 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828949 spots for SRR3241533.sra Written 828949 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra Read 828932 spots for SRR3241533.sra Written 828932 spots for SRR3241533.sra SRR ids: ['SRR3241533.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_57hicam9 SRR3241533.sra spots: 16578657 blocks: [[1, 828932], [828933, 1657864], [1657865, 2486796], [2486797, 3315728], [3315729, 4144660], [4144661, 4973592], [4973593, 5802524], [5802525, 6631456], [6631457, 7460388], [7460389, 8289320], [8289321, 9118252], [9118253, 9947184], [9947185, 10776116], [10776117, 11605048], [11605049, 12433980], [12433981, 13262912], [13262913, 14091844], [14091845, 14920776], [14920777, 15749708], [15749709, 16578657]] SRR3241533 file size 4319765 SRR3241533 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241533 SRR3241533_1.fastq Input file: SRR3241533_1.fastq trimmed: SRR3241533-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:04:18 2025 >> started Mon Feb 10 16:04:26 2025 >> done (8.244s) 16578657 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 16578657 (100.00%) reads available; of these: 646967 ( 3.90%) trimmed reads available after processing 15931690 (96.10%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 51 1404 0.01% 52 1928 0.01% 53 2405 0.01% 54 2952 0.02% 55 3311 0.02% 56 3610 0.02% 57 3836 0.02% 58 4048 0.02% 59 4231 0.03% 60 4563 0.03% 61 4575 0.03% 62 4700 0.03% 63 4863 0.03% 64 4984 0.03% 65 5235 0.03% 66 5274 0.03% 67 5615 0.03% 68 5763 0.03% 69 5950 0.04% 70 6292 0.04% 71 6573 0.04% 72 6942 0.04% 73 7360 0.04% 74 7827 0.05% 75 8092 0.05% 76 4853 0.03% 77 5746 0.03% 78 6460 0.04% 79 7086 0.04% 80 7544 0.05% 81 8190 0.05% 82 8764 0.05% 83 9500 0.06% 84 10280 0.06% 85 10887 0.07% 86 11573 0.07% 87 12460 0.08% 88 13630 0.08% 89 14973 0.09% 90 16304 0.10% 91 18922 0.11% 92 21248 0.13% 93 25075 0.15% 94 29698 0.18% 95 34753 0.21% 96 42083 0.25% 97 56720 0.34% 98 77310 0.47% 99 70575 0.43% 100 15931690 96.10% 16578657 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=32 prefix-density=0.09 prefix-fanout=2.7 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=368.75 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=23.7 sequence=AAAAGAAAAAAGATACACACGGCCATACATAATACACGGACCTCAATTCACCAGATTTTCAAGGCAGCACATAATATTTATTATAAATCAAGTCGTCAGCTATGTTCTTAGCTTCTTACTTACTCCGCACGCTGTTCTTCAACCATCTCCAAGGGGAAATGAGGAGACCCCCGAGGGCAAAAGATAACCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCTCGAAGGGTCATCCTGGGGATAGCTGTAAGAAGTAGGGCACCTATCCTTAAAAAACCTTGAGAAATAGGTAGGGCCACAGCTCCCCTGCCCATTAGTGCAGCAATATTCGTTAGTTTTAAACACAGTGCATGGGTTATTACACCCACCAGGAGCCCTCAATTCATTAGGACATTGCCCATTAATATCTGCTGTGCAGAGAAGCGCCTGACACTTCCCTGAGCCACCGCTTGATGTTGGACTAAATTCCATAGGGATATTAAATCCATCAACAAGGGATATATCATAAA Started job on | Feb 10 16:04:44 Started mapping on | Feb 10 16:04:44 Finished on | Feb 10 16:05:01 Mapping speed, Million of reads per hour | 3510.77 Number of input reads | 16578657 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15825568 Uniquely mapped reads % | 95.46% Average mapped length | 99.25 Number of splices: Total | 4073295 Number of splices: Annotated (sjdb) | 3985509 Number of splices: GT/AG | 4006615 Number of splices: GC/AG | 53991 Number of splices: AT/AC | 4366 Number of splices: Non-canonical | 8323 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.06 Insertion rate per base | 0.02% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 523278 % of reads mapped to multiple loci | 3.16% Number of reads mapped to too many loci | 119998 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 229811 229811 229811 N_multimapping 523278 523278 523278 N_noFeature 776581 8151745 8330126 N_ambiguous 176209 28212 28131 UnstrandedReadsAssigned:14872778 PositiveStrandReadsAssigned:7645611 NegativeStrandReadsAssigned:7467311 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241533 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241533-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,578,657 reads, 15,382,294 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,219 rounds 52401 SRR3241533.ke.tsv 34699 SRR3241533.se.tsv 87100 total ==> SRR3241533.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2008 85.3703 Potri.005G024800.1.v4.1 1035 936 9561 833.385 Potri.004G059700.1.v4.1 961 862 39 3.69127 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 486.327 13.9514 Potri.016G087400.1.v4.1 270 171 647 308.693 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 443 21.5907 Potri.012G127500.1.v4.1 977 878 644 59.8425 ==> SRR3241533.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 259 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 463 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR3241533 completed mapping pipeline successfully