Starting /dee2/code/volunteer_pipeline.sh SRR3241534 current disk space = 3058422448128 free memory = 1520815752 SRR3241534 SRAfilesize dd59cf20ffd2935e02d8a662177a02be SRR3241534.sra SRR3241534.sra file validated SRR3241534 is single end SRR3241534 is conventional basespace SRR3241534 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241534_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0455 34.0 33.0 34.0 31.0 34.0 2 33.215 34.0 34.0 34.0 31.0 34.0 3 33.30125 34.0 34.0 34.0 31.0 34.0 4 36.61 37.0 37.0 37.0 35.0 37.0 5 36.55675 37.0 37.0 37.0 35.0 37.0 6 36.5155 37.0 37.0 37.0 35.0 37.0 7 36.51225 37.0 37.0 37.0 35.0 37.0 8 36.49475 37.0 37.0 37.0 35.0 37.0 9 38.3355 39.0 39.0 39.0 37.0 39.0 10-11 38.334625 39.0 39.0 39.0 37.0 39.0 12-13 38.224125 39.0 39.0 39.0 37.0 39.0 14-15 39.894375 41.0 40.0 41.0 38.0 41.0 16-17 39.922 41.0 40.0 41.0 38.0 41.0 18-19 39.91675 41.0 40.0 41.0 38.0 41.0 20-21 39.75875 41.0 40.0 41.0 38.0 41.0 22-23 39.767875000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.780125 41.0 40.0 41.0 37.5 41.0 26-27 39.605125 41.0 40.0 41.0 37.0 41.0 28-29 39.639 41.0 40.0 41.0 37.0 41.0 30-31 39.539249999999996 41.0 40.0 41.0 37.0 41.0 32-33 39.337875 41.0 39.0 41.0 36.5 41.0 34-35 39.31825 41.0 39.0 41.0 36.0 41.0 36-37 39.52475 41.0 40.0 41.0 37.0 41.0 38-39 39.30525 41.0 39.5 41.0 36.5 41.0 40-41 39.55475 41.0 40.0 41.0 37.0 41.0 42-43 39.69175 41.0 40.0 41.0 37.0 41.0 44-45 39.464125 41.0 40.0 41.0 36.5 41.0 46-47 39.560875 41.0 40.0 41.0 37.0 41.0 48-49 39.378875 41.0 39.0 41.0 36.5 41.0 50-51 39.383750000000006 41.0 39.0 41.0 36.0 41.0 52-53 39.190875000000005 41.0 39.0 41.0 35.5 41.0 54-55 38.827375 40.0 38.5 41.0 35.0 41.0 56-57 38.671875 40.0 38.0 41.0 35.0 41.0 58-59 38.785125 40.0 38.0 41.0 35.0 41.0 60-61 38.494625 40.0 37.5 41.0 35.0 41.0 62-63 38.218875 40.0 37.0 41.0 34.5 41.0 64-65 37.961124999999996 39.0 36.5 41.0 34.0 41.0 66-67 37.611125 39.0 36.0 41.0 34.0 41.0 68-69 37.34475 38.5 35.5 40.0 34.0 41.0 70-71 36.867374999999996 37.0 35.0 40.0 34.0 41.0 72-73 36.468125 37.0 35.0 39.0 33.5 41.0 74-75 36.025625 36.5 35.0 39.0 33.0 40.0 76-77 34.686625 35.0 33.5 37.0 31.0 39.0 78-79 35.145375 35.0 35.0 37.0 33.0 39.0 80-81 34.8685 35.0 35.0 37.0 32.5 39.0 82-83 34.617999999999995 35.0 35.0 36.0 32.0 37.0 84-85 34.283375 35.0 35.0 36.0 32.0 37.0 86-87 34.082750000000004 35.0 34.0 36.0 32.0 36.5 88-89 33.875 35.0 34.0 35.0 31.5 36.0 90-91 33.771625 35.0 34.0 35.0 31.0 36.0 92-93 33.713125 35.0 34.0 35.0 31.5 36.0 94-95 33.639250000000004 35.0 34.0 35.0 32.0 36.0 96-97 33.264624999999995 35.0 34.0 35.0 31.0 35.0 98-99 33.084125 35.0 34.0 35.0 30.5 35.0 100 32.8745 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.1745885450954603 1101 2 0.049572086899274836 1101 3 0.03739302172481729 1101 4 0.03824884792626193 1101 5 0.0601053324555636 1101 6 0.031863067807769596 1101 7 0.0377221856484482 1101 8 0.10849242922975577 1101 9 0.07393021724818993 1101 10-11 0.1411784068466133 1101 12-13 0.005562870309411494 1101 14-15 0.016425279789338276 1101 16-17 0.12722185648453177 1101 18-19 0.2575049374588545 1101 20-21 0.23232389730085856 1101 22-23 0.05994075049374459 1101 24-25 0.07429229756418465 1101 26-27 -0.0414088215931514 1101 28-29 -0.040882159315337674 1101 30-31 0.15148123765635546 1101 32-33 -0.10243581303489435 1101 34-35 0.09940750493746009 1101 36-37 0.14045424621460967 1101 38-39 -0.5102369980250145 1101 40-41 -0.07662936142199328 1101 42-43 1.3166556944810281E-4 1101 44-45 0.23215931533903955 1101 46-47 0.1145490454246243 1101 48-49 0.1598749177090184 1101 50-51 0.21471362738643762 1101 52-53 0.29970375246872294 1101 54-55 0.04078341013825337 1101 56-57 -0.11869651086240651 1101 58-59 0.06859776168531795 1101 60-61 0.34878209348255496 1101 62-63 0.38614219881500844 1101 64-65 0.33373930217248216 1101 66-67 0.39763001974983325 1101 68-69 0.42353522053983284 1101 70-71 0.5081632653061234 1101 72-73 0.35253456221197865 1101 74-75 0.3573074391046731 1101 76-77 0.5874917709019059 1101 78-79 0.3683673469387756 1101 80-81 0.46310072416063264 1101 82-83 0.2178406846609633 1101 84-85 0.267116524028971 1101 86-87 0.3967741935483886 1101 88-89 0.3081961816984915 1101 90-91 0.29440421329822186 1101 92-93 0.010829493087555875 1101 94-95 0.007801184990128718 1101 96-97 -0.03505595786702287 1101 98-99 0.13449637919683965 1101 100 0.1971691902567514 1106 1 -0.17458854509545318 1106 2 -0.049572086899274836 1106 3 -0.03739302172482439 1106 4 -0.038248847926269036 1106 5 -0.0601053324555636 1106 6 -0.031863067807769596 1106 7 -0.03772218564845531 1106 8 -0.10849242922975577 1106 9 -0.07393021724818993 1106 10-11 -0.1411784068466062 1106 12-13 -0.005562870309411494 1106 14-15 -0.016425279789338276 1106 16-17 -0.12722185648453177 1106 18-19 -0.2575049374588545 1106 20-21 -0.23232389730085146 1106 22-23 -0.05994075049374459 1106 24-25 -0.07429229756418465 1106 26-27 0.0414088215931514 1106 28-29 0.040882159315337674 1106 30-31 -0.15148123765634836 1106 32-33 0.10243581303489435 1106 34-35 -0.09940750493746009 1106 36-37 -0.14045424621460967 1106 38-39 0.5102369980250145 1106 40-41 0.07662936142198618 1106 42-43 -1.3166556945520824E-4 1106 44-45 -0.23215931533903955 1106 46-47 -0.1145490454246243 1106 48-49 -0.1598749177090184 1106 50-51 -0.21471362738643762 1106 52-53 -0.29970375246873004 1106 54-55 -0.04078341013824627 1106 56-57 0.11869651086240651 1106 58-59 -0.06859776168531795 1106 60-61 -0.34878209348255496 1106 62-63 -0.38614219881500844 1106 64-65 -0.33373930217248216 1106 66-67 -0.39763001974983325 1106 68-69 -0.42353522053982573 1106 70-71 -0.5081632653061234 1106 72-73 -0.35253456221197865 1106 74-75 -0.3573074391046731 1106 76-77 -0.5874917709019059 1106 78-79 -0.3683673469387756 1106 80-81 -0.46310072416063264 1106 82-83 -0.2178406846609633 1106 84-85 -0.2671165240289639 1106 86-87 -0.3967741935483815 1106 88-89 -0.3081961816984844 1106 90-91 -0.29440421329822186 1106 92-93 -0.01082949308756298 1106 94-95 -0.007801184990128718 1106 96-97 0.03505595786701576 1106 98-99 -0.13449637919683965 1106 100 -0.1971691902567443 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 3.0 18 4.0 19 5.0 20 4.0 21 6.0 22 5.0 23 8.0 24 8.0 25 7.0 26 10.0 27 16.0 28 13.0 29 16.0 30 33.0 31 37.0 32 59.0 33 72.0 34 102.0 35 144.0 36 286.0 37 888.0 38 1815.0 39 458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.66331658291457 14.195979899497488 19.020100502512562 44.120603015075375 2 19.55 22.775000000000002 36.625 21.05 3 22.95 26.924999999999997 26.35 23.775 4 24.474999999999998 32.275 20.225 23.025000000000002 5 24.075 35.699999999999996 22.875 17.349999999999998 6 20.0 36.625 23.5 19.875 7 16.625 18.725 43.575 21.075 8 19.400000000000002 24.4 29.299999999999997 26.900000000000002 9 19.400000000000002 24.125 32.4 24.075 10-11 21.6875 33.875 22.9625 21.475 12-13 20.549999999999997 27.0125 29.9375 22.5 14-15 20.925 29.1375 28.349999999999998 21.587500000000002 16-17 22.175 28.9875 27.287499999999998 21.55 18-19 21.712500000000002 29.299999999999997 26.0625 22.925 20-21 21.025 30.362499999999997 27.200000000000003 21.4125 22-23 21.6125 29.062500000000004 27.8875 21.4375 24-25 22.0 29.45 27.8125 20.7375 26-27 20.825 29.799999999999997 27.1625 22.2125 28-29 21.2875 28.7375 27.55 22.425 30-31 21.212500000000002 29.037499999999998 27.474999999999998 22.275 32-33 21.6125 28.475 28.3875 21.525 34-35 22.15 29.299999999999997 27.3375 21.212500000000002 36-37 21.8 28.95 27.537499999999998 21.712500000000002 38-39 22.912499999999998 28.225 27.0875 21.775 40-41 21.0625 28.275 27.650000000000002 23.0125 42-43 21.4 29.125 27.5625 21.912499999999998 44-45 20.974999999999998 28.9 28.925 21.2 46-47 20.6875 29.125 27.750000000000004 22.4375 48-49 22.1 29.225 27.474999999999998 21.2 50-51 22.725 28.262500000000003 27.875 21.1375 52-53 21.025 28.487499999999997 28.6875 21.8 54-55 20.925 28.712500000000002 28.1 22.2625 56-57 21.6625 28.625 27.5125 22.2 58-59 21.7875 28.375 28.3125 21.525 60-61 21.337500000000002 28.537499999999998 28.5875 21.5375 62-63 21.2375 28.787499999999998 28.299999999999997 21.675 64-65 20.837500000000002 29.099999999999998 28.6875 21.375 66-67 21.925 27.925 27.8625 22.287499999999998 68-69 21.212500000000002 28.4 28.212500000000002 22.175 70-71 22.7 27.9125 28.1875 21.2 72-73 21.587500000000002 29.1375 28.025 21.25 74-75 21.6875 28.6625 28.1875 21.462500000000002 76-77 21.875 28.050000000000004 28.275 21.8 78-79 21.6625 27.950000000000003 28.65 21.7375 80-81 21.875 27.8875 28.1875 22.05 82-83 21.575 28.625 27.8125 21.987499999999997 84-85 21.9625 29.049999999999997 28.287499999999998 20.7 86-87 21.6625 29.075 28.1 21.1625 88-89 20.9 29.475 28.199999999999996 21.425 90-91 20.7875 28.287499999999998 28.549999999999997 22.375 92-93 21.925 28.512500000000003 28.012500000000003 21.55 94-95 21.3 28.425 29.575000000000003 20.7 96-97 21.7375 28.1625 28.525 21.575 98-99 21.85 28.875 28.0625 21.212500000000002 100 23.075000000000003 28.449999999999996 26.325 22.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 2.5 26 6.5 27 8.0 28 10.5 29 17.0 30 24.0 31 40.0 32 48.0 33 60.0 34 73.5 35 85.0 36 114.0 37 140.5 38 156.5 39 170.5 40 202.5 41 230.0 42 238.0 43 253.0 44 256.0 45 251.0 46 239.0 47 239.0 48 222.0 49 174.5 50 155.5 51 131.5 52 99.0 53 79.5 54 63.0 55 47.0 56 32.0 57 26.5 58 23.0 59 17.5 60 13.5 61 10.0 62 8.0 63 5.5 64 4.5 65 3.0 66 1.5 67 1.5 68 3.5 69 3.0 70 1.5 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658952 spots for SRR3241534.sra Written 658952 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra Read 658944 spots for SRR3241534.sra Written 658944 spots for SRR3241534.sra SRR ids: ['SRR3241534.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hwun112d SRR3241534.sra spots: 13178888 blocks: [[1, 658944], [658945, 1317888], [1317889, 1976832], [1976833, 2635776], [2635777, 3294720], [3294721, 3953664], [3953665, 4612608], [4612609, 5271552], [5271553, 5930496], [5930497, 6589440], [6589441, 7248384], [7248385, 7907328], [7907329, 8566272], [8566273, 9225216], [9225217, 9884160], [9884161, 10543104], [10543105, 11202048], [11202049, 11860992], [11860993, 12519936], [12519937, 13178888]] SRR3241534 file size 3431688 SRR3241534 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241534 SRR3241534_1.fastq Input file: SRR3241534_1.fastq trimmed: SRR3241534-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:26:19 2025 >> started Mon Feb 10 16:26:26 2025 >> done (6.504s) 13178888 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 13178888 (100.00%) reads available; of these: 528701 ( 4.01%) trimmed reads available after processing 12650187 (95.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 40 1 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 1 0.00% 49 0 0.00% 50 0 0.00% 51 1131 0.01% 52 1569 0.01% 53 2109 0.02% 54 2427 0.02% 55 2773 0.02% 56 2913 0.02% 57 3244 0.02% 58 3447 0.03% 59 3625 0.03% 60 3834 0.03% 61 3919 0.03% 62 3924 0.03% 63 4000 0.03% 64 4217 0.03% 65 4298 0.03% 66 4367 0.03% 67 4654 0.04% 68 4750 0.04% 69 4932 0.04% 70 5269 0.04% 71 5396 0.04% 72 5669 0.04% 73 5867 0.04% 74 6248 0.05% 75 6699 0.05% 76 3980 0.03% 77 4455 0.03% 78 5352 0.04% 79 5788 0.04% 80 6279 0.05% 81 6789 0.05% 82 6944 0.05% 83 7568 0.06% 84 8393 0.06% 85 8776 0.07% 86 9271 0.07% 87 10006 0.08% 88 10973 0.08% 89 12299 0.09% 90 13279 0.10% 91 15135 0.11% 92 17456 0.13% 93 20454 0.16% 94 24481 0.19% 95 28494 0.22% 96 34243 0.26% 97 46720 0.35% 98 62255 0.47% 99 58028 0.44% 100 12650187 95.99% 13178888 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=4.29 fanout-score-rank=29 prefix-density=0.08 prefix-fanout=4.2 sequence=CAAGGTGGGTACAACCAACAAGAGCACAGGGGCGGCGCACAAGGTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=351.94 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=26.3 sequence=AAGAAGAAGAAG Started job on | Feb 10 16:26:43 Started mapping on | Feb 10 16:26:43 Finished on | Feb 10 16:27:03 Mapping speed, Million of reads per hour | 2372.20 Number of input reads | 13178888 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12475168 Uniquely mapped reads % | 94.66% Average mapped length | 99.23 Number of splices: Total | 3332365 Number of splices: Annotated (sjdb) | 3253399 Number of splices: GT/AG | 3277882 Number of splices: GC/AG | 44424 Number of splices: AT/AC | 3083 Number of splices: Non-canonical | 6976 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.02% Insertion average length | 1.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390459 % of reads mapped to multiple loci | 2.96% Number of reads mapped to too many loci | 244287 % of reads mapped to too many loci | 1.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 313261 313261 313261 N_multimapping 390459 390459 390459 N_noFeature 591897 6473202 6504542 N_ambiguous 135509 23431 23138 UnstrandedReadsAssigned:11747762 PositiveStrandReadsAssigned:5978535 NegativeStrandReadsAssigned:5947488 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241534 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241534-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,178,888 reads, 12,261,024 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,251 rounds 52401 SRR3241534.ke.tsv 34699 SRR3241534.se.tsv 87100 total ==> SRR3241534.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1854 97.53 Potri.005G024800.1.v4.1 1035 936 7464 805.006 Potri.004G059700.1.v4.1 961 862 12 1.40533 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 475.218 16.8681 Potri.016G087400.1.v4.1 270 171 496 292.812 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 218 13.1463 Potri.012G127500.1.v4.1 977 878 967 111.182 ==> SRR3241534.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 79 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 245 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 7 SRR3241534 completed mapping pipeline successfully