Starting /dee2/code/volunteer_pipeline.sh SRR3241535 current disk space = 3058830110720 free memory = 1414683704 SRR3241535 SRAfilesize bbf086db750cee46e2f05f73f390cbf7 SRR3241535.sra SRR3241535.sra file validated SRR3241535 is single end SRR3241535 is conventional basespace SRR3241535 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241535_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.17525 34.0 33.0 34.0 31.0 34.0 2 33.29825 34.0 34.0 34.0 31.0 34.0 3 33.351 34.0 34.0 34.0 31.0 34.0 4 36.6215 37.0 37.0 37.0 35.0 37.0 5 36.59325 37.0 37.0 37.0 35.0 37.0 6 36.4885 37.0 37.0 37.0 35.0 37.0 7 36.5445 37.0 37.0 37.0 35.0 37.0 8 36.5185 37.0 37.0 37.0 35.0 37.0 9 38.37875 39.0 39.0 39.0 37.0 39.0 10-11 38.446124999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.301125 39.0 39.0 39.0 37.0 39.0 14-15 39.978375 41.0 40.0 41.0 38.0 41.0 16-17 39.994375000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.976 41.0 40.0 41.0 38.0 41.0 20-21 39.85875 41.0 40.0 41.0 38.0 41.0 22-23 39.873374999999996 41.0 40.0 41.0 38.0 41.0 24-25 39.88175 41.0 40.0 41.0 38.0 41.0 26-27 39.663 41.0 40.0 41.0 37.0 41.0 28-29 39.710125000000005 41.0 40.0 41.0 38.0 41.0 30-31 39.59125 41.0 40.0 41.0 37.0 41.0 32-33 39.473875 41.0 39.5 41.0 37.0 41.0 34-35 39.4975 41.0 40.0 41.0 37.0 41.0 36-37 39.706125 41.0 40.0 41.0 38.0 41.0 38-39 39.484750000000005 41.0 40.0 41.0 37.0 41.0 40-41 39.661 41.0 40.0 41.0 37.0 41.0 42-43 39.711124999999996 41.0 40.0 41.0 37.5 41.0 44-45 39.598 41.0 40.0 41.0 37.0 41.0 46-47 39.681875000000005 41.0 40.0 41.0 37.0 41.0 48-49 39.564750000000004 41.0 40.0 41.0 37.0 41.0 50-51 39.433499999999995 41.0 39.5 41.0 36.0 41.0 52-53 39.38575 41.0 39.0 41.0 36.0 41.0 54-55 38.9465 40.5 39.0 41.0 35.0 41.0 56-57 38.813125 40.0 38.5 41.0 35.0 41.0 58-59 38.869749999999996 40.0 38.5 41.0 35.0 41.0 60-61 38.67275 40.0 38.0 41.0 35.0 41.0 62-63 38.45425 40.0 37.0 41.0 35.0 41.0 64-65 38.219375 39.5 37.0 41.0 34.5 41.0 66-67 37.75725 39.0 36.0 41.0 34.0 41.0 68-69 37.545125 39.0 36.0 40.5 34.0 41.0 70-71 37.074375 37.5 35.0 40.0 34.0 41.0 72-73 36.70775 37.0 35.0 39.0 34.0 41.0 74-75 36.197375 36.5 35.0 39.0 33.0 40.5 76-77 34.791375 35.0 33.5 37.0 31.0 39.0 78-79 35.324749999999995 36.0 35.0 37.0 32.5 39.0 80-81 35.026250000000005 35.0 35.0 37.0 32.5 39.0 82-83 34.7495 35.0 35.0 36.0 32.5 37.0 84-85 34.4435 35.0 35.0 36.0 32.0 37.0 86-87 34.24075 35.0 35.0 36.0 32.0 37.0 88-89 34.034625 35.0 34.5 35.0 31.5 36.0 90-91 33.910250000000005 35.0 34.0 35.0 32.0 36.0 92-93 33.78725 35.0 34.0 35.0 32.0 36.0 94-95 33.69 35.0 34.0 35.0 32.0 36.0 96-97 33.38275 35.0 34.0 35.0 31.0 35.5 98-99 33.227000000000004 35.0 34.0 35.0 31.0 35.0 100 33.1245 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.023904282746364913 1101 2 0.1457285174338594 1101 3 0.05593101549398227 1101 4 0.09271357412830383 1101 5 0.15537783785136838 1101 6 0.15660434031688908 1101 7 0.08476633876498596 1101 8 0.04160096117744416 1101 9 0.23247227854120922 1101 10-11 0.0923506295211638 1101 12-13 0.12092313083527273 1101 14-15 0.07574278491151887 1101 16-17 0.14908262621711543 1101 18-19 -0.014017171034517162 1101 20-21 0.10818252359139535 1101 22-23 0.024892993917546846 1101 24-25 0.04115666691697584 1101 26-27 0.09099897374283472 1101 28-29 0.05671948136467364 1101 30-31 0.15199869840554925 1101 32-33 0.013967109709390968 1101 34-35 0.21971289830041485 1101 36-37 0.19698505669444444 1101 38-39 -0.22774148331706812 1101 40-41 0.08264499011288962 1101 42-43 0.016964531551145967 1101 44-45 0.2055768316187354 1101 46-47 0.0941653525568853 1101 48-49 0.20035168080899268 1101 50-51 0.2733848964982144 1101 52-53 0.05106255162574058 1101 54-55 -0.17353132587419395 1101 56-57 -0.20458812044754637 1101 58-59 -0.06583690020275412 1101 60-61 0.13111061049785633 1101 62-63 0.08637455883457079 1101 64-65 0.1816725488723705 1101 66-67 0.04627543741082718 1101 68-69 -0.15905734524793047 1101 70-71 0.06215113514054593 1101 72-73 0.16212985907736766 1101 74-75 -0.011820730394731527 1101 76-77 0.28337838852593933 1101 78-79 0.008228830317136726 1101 80-81 0.26350404245200565 1101 82-83 0.13770619008284513 1101 84-85 0.13858852093814988 1101 86-87 0.29595629646316723 1101 88-89 0.14247453130084864 1101 90-91 0.07728217065906051 1101 92-93 0.13763735576080904 1101 94-95 0.07844609646817702 1101 96-97 0.03758353983629803 1101 98-99 0.14420790468324185 1101 100 0.09728167004580257 1106 1 -0.023904282746364913 1106 2 -0.1457285174338594 1106 3 -0.05593101549398227 1106 4 -0.09271357412831094 1106 5 -0.15537783785136838 1106 6 -0.15660434031688908 1106 7 -0.08476633876499307 1106 8 -0.04160096117744416 1106 9 -0.23247227854121633 1106 10-11 -0.0923506295211638 1106 12-13 -0.12092313083527273 1106 14-15 -0.07574278491151176 1106 16-17 -0.14908262621711543 1106 18-19 0.014017171034517162 1106 20-21 -0.10818252359140246 1106 22-23 -0.02489299391755395 1106 24-25 -0.04115666691697584 1106 26-27 -0.09099897374283472 1106 28-29 -0.05671948136467364 1106 30-31 -0.15199869840554925 1106 32-33 -0.013967109709390968 1106 34-35 -0.21971289830042195 1106 36-37 -0.19698505669445154 1106 38-39 0.227741483317061 1106 40-41 -0.08264499011288251 1106 42-43 -0.016964531551145967 1106 44-45 -0.2055768316187283 1106 46-47 -0.09416535255687819 1106 48-49 -0.20035168080899268 1106 50-51 -0.2733848964982073 1106 52-53 -0.05106255162574058 1106 54-55 0.17353132587419395 1106 56-57 0.20458812044755348 1106 58-59 0.06583690020274702 1106 60-61 -0.13111061049786343 1106 62-63 -0.08637455883457079 1106 64-65 -0.1816725488723634 1106 66-67 -0.04627543741082718 1106 68-69 0.15905734524792337 1106 70-71 -0.06215113514055304 1106 72-73 -0.16212985907736766 1106 74-75 0.011820730394731527 1106 76-77 -0.28337838852594643 1106 78-79 -0.008228830317136726 1106 80-81 -0.26350404245199854 1106 82-83 -0.13770619008285223 1106 84-85 -0.13858852093814988 1106 86-87 -0.29595629646316723 1106 88-89 -0.14247453130084153 1106 90-91 -0.07728217065906051 1106 92-93 -0.13763735576080904 1106 94-95 -0.07844609646817702 1106 96-97 -0.03758353983629803 1106 98-99 -0.14420790468323474 1106 100 -0.09728167004580968 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 2.0 20 5.0 21 0.0 22 5.0 23 5.0 24 6.0 25 9.0 26 13.0 27 16.0 28 16.0 29 26.0 30 28.0 31 24.0 32 58.0 33 76.0 34 89.0 35 144.0 36 275.0 37 802.0 38 1871.0 39 528.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.921765295887663 14.9197592778335 18.254764292878637 42.9037111334002 2 19.825 22.55 37.75 19.875 3 22.425 26.974999999999998 27.975 22.625 4 24.6 32.7 21.224999999999998 21.475 5 24.65 35.175 23.674999999999997 16.5 6 19.575 38.875 22.400000000000002 19.15 7 16.950000000000003 19.15 45.025 18.875 8 18.55 24.25 29.5 27.700000000000003 9 19.15 25.025 32.35 23.474999999999998 10-11 22.4875 34.025 22.525000000000002 20.962500000000002 12-13 20.2125 27.462500000000002 30.912499999999998 21.4125 14-15 20.549999999999997 28.499999999999996 29.7 21.25 16-17 20.65 28.962500000000002 27.8625 22.525000000000002 18-19 21.1625 28.725 28.525 21.587500000000002 20-21 21.8875 28.9 27.437499999999996 21.775 22-23 20.849999999999998 29.075 28.999999999999996 21.075 24-25 21.637500000000003 28.725 28.325 21.3125 26-27 20.849999999999998 29.762499999999996 28.125 21.2625 28-29 21.025 28.9 27.987499999999997 22.0875 30-31 20.8125 28.925 28.675 21.587500000000002 32-33 21.725 29.099999999999998 27.762500000000003 21.4125 34-35 21.1375 28.9 27.4125 22.55 36-37 21.224999999999998 29.775000000000002 27.200000000000003 21.8 38-39 20.775 29.25 28.1625 21.8125 40-41 20.625 28.775000000000002 28.825 21.775 42-43 20.5 28.625 28.999999999999996 21.875 44-45 20.7875 28.262500000000003 28.9125 22.037499999999998 46-47 21.8 29.312500000000004 28.487499999999997 20.4 48-49 21.6 28.449999999999996 27.987499999999997 21.9625 50-51 22.1875 28.65 27.8125 21.349999999999998 52-53 21.25 30.599999999999998 27.400000000000002 20.75 54-55 21.3 28.9375 28.125 21.637500000000003 56-57 21.275 29.062500000000004 27.987499999999997 21.675 58-59 21.462500000000002 29.4875 28.475 20.575 60-61 21.075 28.9125 27.5875 22.425 62-63 21.4375 28.599999999999998 28.675 21.2875 64-65 21.224999999999998 28.575 29.075 21.125 66-67 20.5 29.675 28.325 21.5 68-69 21.837500000000002 28.3125 28.8625 20.9875 70-71 21.875 29.325000000000003 27.6875 21.1125 72-73 21.099999999999998 29.325000000000003 28.8875 20.6875 74-75 21.0125 29.125 28.999999999999996 20.8625 76-77 21.65 28.5625 28.9375 20.849999999999998 78-79 20.474999999999998 29.762499999999996 28.9125 20.849999999999998 80-81 21.85 26.875 29.325000000000003 21.95 82-83 21.087500000000002 28.3375 29.25 21.325 84-85 20.424999999999997 28.9375 29.5875 21.05 86-87 21.025 28.4375 29.299999999999997 21.2375 88-89 21.6 28.449999999999996 28.6625 21.2875 90-91 21.15 28.925 28.675 21.25 92-93 21.3875 28.625 28.875 21.1125 94-95 21.95 29.075 28.212500000000002 20.7625 96-97 21.212500000000002 28.9 28.487499999999997 21.4 98-99 22.037499999999998 28.7375 28.675 20.549999999999997 100 22.225 28.775000000000002 28.425 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 2.5 24 5.5 25 7.5 26 10.0 27 12.0 28 13.5 29 23.0 30 38.0 31 46.0 32 55.0 33 73.0 34 93.5 35 108.0 36 121.5 37 131.5 38 170.0 39 193.5 40 202.0 41 232.0 42 244.5 43 247.5 44 250.5 45 238.5 46 218.5 47 228.5 48 208.0 49 158.5 50 134.0 51 125.0 52 98.0 53 69.0 54 59.5 55 43.0 56 30.0 57 27.0 58 24.0 59 15.5 60 9.5 61 7.5 62 5.0 63 3.5 64 4.0 65 3.5 66 1.0 67 0.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659871 spots for SRR3241535.sra Written 659871 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra Read 659870 spots for SRR3241535.sra Written 659870 spots for SRR3241535.sra SRR ids: ['SRR3241535.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6_9l3dud SRR3241535.sra spots: 13197401 blocks: [[1, 659870], [659871, 1319740], [1319741, 1979610], [1979611, 2639480], [2639481, 3299350], [3299351, 3959220], [3959221, 4619090], [4619091, 5278960], [5278961, 5938830], [5938831, 6598700], [6598701, 7258570], [7258571, 7918440], [7918441, 8578310], [8578311, 9238180], [9238181, 9898050], [9898051, 10557920], [10557921, 11217790], [11217791, 11877660], [11877661, 12537530], [12537531, 13197401]] SRR3241535 file size 3436526 SRR3241535 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241535 SRR3241535_1.fastq Input file: SRR3241535_1.fastq trimmed: SRR3241535-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:43:32 2025 >> started Mon Feb 10 15:43:44 2025 >> done (11.751s) 13197401 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 13197401 (100.00%) reads available; of these: 505481 ( 3.83%) trimmed reads available after processing 12691920 (96.17%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 47 1 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1129 0.01% 52 1454 0.01% 53 1801 0.01% 54 2223 0.02% 55 2611 0.02% 56 2886 0.02% 57 3004 0.02% 58 3135 0.02% 59 3380 0.03% 60 3509 0.03% 61 3497 0.03% 62 3699 0.03% 63 3653 0.03% 64 3915 0.03% 65 3985 0.03% 66 4167 0.03% 67 4317 0.03% 68 4396 0.03% 69 4674 0.04% 70 4928 0.04% 71 5073 0.04% 72 5391 0.04% 73 5646 0.04% 74 5933 0.04% 75 6265 0.05% 76 3821 0.03% 77 4277 0.03% 78 5254 0.04% 79 5514 0.04% 80 5949 0.05% 81 6387 0.05% 82 6811 0.05% 83 7214 0.05% 84 7860 0.06% 85 8484 0.06% 86 9043 0.07% 87 9579 0.07% 88 10519 0.08% 89 11448 0.09% 90 12842 0.10% 91 14736 0.11% 92 16502 0.13% 93 19821 0.15% 94 23472 0.18% 95 27104 0.21% 96 33217 0.25% 97 44860 0.34% 98 60511 0.46% 99 55584 0.42% 100 12691920 96.17% 13197401 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=54.51 fanout-score-rank=9 prefix-density=0.36 prefix-fanout=12.7 sequence=AAAAAGAAAAAAGATACACACGGCCATACATAATACACGGACCTCAATTCACCAGATTTTCAAGGCAGCACATAATATTTATTATAAATCAAGTCGTCAGCTATGTTCTTAGCTTCTTACTTACTCCGCACGCTGTTCTTCAACCATCTCCAAGGGGAAATGAGGAGACCCCCGAGGGCAAAAGATAACCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCTCGAAGGGTCATCCTGGGGATAGCTGTAAGAAGTAGGGCACCTATCCTTAAAAAACCTTGAGAAATAGGTAGGGCCACAGCTCCCCTGCCCATTAGTGCAGCAATATTCGTTAGTTTTAAACACAGTGCATGGGTTATTACACCCACCAGGAGCCCTCAATTCATTAGGACATTGCCCATTAATATCTGCTGTGCAGAGAAGCGCCTGACACTTCCCTGAGCCACCGCTTGATGTTGGACTAAATTCCATAGGGATATTAAATCCATCAACAAGGGATATATCATAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=220.78 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=25.0 sequence=TTCTTCTTCTTT Started job on | Feb 10 15:44:13 Started mapping on | Feb 10 15:44:13 Finished on | Feb 10 15:44:31 Mapping speed, Million of reads per hour | 2639.48 Number of input reads | 13197401 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12723574 Uniquely mapped reads % | 96.41% Average mapped length | 99.23 Number of splices: Total | 3135531 Number of splices: Annotated (sjdb) | 3053965 Number of splices: GT/AG | 3082884 Number of splices: GC/AG | 43140 Number of splices: AT/AC | 2804 Number of splices: Non-canonical | 6703 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323176 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 81593 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 150651 150651 150651 N_multimapping 323176 323176 323176 N_noFeature 748681 6634621 6733486 N_ambiguous 148779 22721 22297 UnstrandedReadsAssigned:11826114 PositiveStrandReadsAssigned:6066232 NegativeStrandReadsAssigned:5967791 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241535 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241535-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,197,401 reads, 12,124,442 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52401 SRR3241535.ke.tsv 34699 SRR3241535.se.tsv 87100 total ==> SRR3241535.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1610 87.5715 Potri.005G024800.1.v4.1 1035 936 5503 613.671 Potri.004G059700.1.v4.1 961 862 11 1.33198 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 383.706 14.0825 Potri.016G087400.1.v4.1 270 171 280 170.913 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 355.566 22.1706 Potri.012G127500.1.v4.1 977 878 2383 283.297 ==> SRR3241535.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 450 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 45 SRR3241535 completed mapping pipeline successfully