Starting /dee2/code/volunteer_pipeline.sh SRR3241536 current disk space = 3058817855488 free memory = 797127828 SRR3241536 SRAfilesize c368b4177ff9524c10a2e70f2c374000 SRR3241536.sra SRR3241536.sra file validated SRR3241536 is single end SRR3241536 is conventional basespace SRR3241536 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241536_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0635 34.0 33.0 34.0 31.0 34.0 2 33.2125 34.0 34.0 34.0 31.0 34.0 3 33.314 34.0 34.0 34.0 31.0 34.0 4 36.57525 37.0 37.0 37.0 35.0 37.0 5 36.57475 37.0 37.0 37.0 35.0 37.0 6 36.44525 37.0 37.0 37.0 35.0 37.0 7 36.49775 37.0 37.0 37.0 35.0 37.0 8 36.44575 37.0 37.0 37.0 35.0 37.0 9 38.3945 39.0 39.0 39.0 37.0 39.0 10-11 38.333875000000006 39.0 39.0 39.0 37.0 39.0 12-13 38.242875 39.0 39.0 39.0 37.0 39.0 14-15 39.747249999999994 41.0 40.0 41.0 37.5 41.0 16-17 39.861875 41.0 40.0 41.0 38.0 41.0 18-19 39.73225 41.0 40.0 41.0 37.5 41.0 20-21 39.747 41.0 40.0 41.0 37.5 41.0 22-23 39.838750000000005 41.0 40.0 41.0 38.0 41.0 24-25 39.805125000000004 41.0 40.0 41.0 38.0 41.0 26-27 39.630250000000004 41.0 40.0 41.0 37.5 41.0 28-29 39.618625 41.0 40.0 41.0 37.0 41.0 30-31 39.347625 41.0 39.0 41.0 36.5 41.0 32-33 39.312 40.5 39.0 41.0 36.5 41.0 34-35 39.297625 40.5 39.0 41.0 36.0 41.0 36-37 39.565875 41.0 39.5 41.0 37.0 41.0 38-39 39.42475 41.0 40.0 41.0 36.5 41.0 40-41 39.554 41.0 40.0 41.0 37.0 41.0 42-43 39.619249999999994 41.0 40.0 41.0 37.0 41.0 44-45 39.54425 41.0 40.0 41.0 37.0 41.0 46-47 39.569125 41.0 40.0 41.0 37.0 41.0 48-49 39.4435 41.0 40.0 41.0 36.5 41.0 50-51 39.256875 41.0 39.0 41.0 36.0 41.0 52-53 39.230374999999995 41.0 39.0 41.0 36.0 41.0 54-55 38.940875000000005 40.5 39.0 41.0 35.0 41.0 56-57 38.741875 40.0 38.0 41.0 35.0 41.0 58-59 38.75125 40.0 38.0 41.0 35.0 41.0 60-61 38.681 40.0 38.0 41.0 35.0 41.0 62-63 38.380125 40.0 37.0 41.0 34.5 41.0 64-65 38.03574999999999 39.5 37.0 41.0 34.0 41.0 66-67 37.732875 39.0 36.0 41.0 34.0 41.0 68-69 37.4685 39.0 36.0 40.5 34.0 41.0 70-71 37.095625 37.5 35.0 40.0 34.0 41.0 72-73 36.63175 37.0 35.0 39.0 33.5 41.0 74-75 36.133250000000004 37.0 35.0 39.0 33.0 40.5 76-77 34.754875 35.5 33.5 37.0 31.0 39.0 78-79 35.2715 36.0 35.0 37.0 32.5 39.0 80-81 35.006125 35.0 35.0 37.0 32.5 39.0 82-83 34.705375000000004 35.0 35.0 36.5 32.0 37.0 84-85 34.419375 35.0 35.0 36.0 32.0 37.0 86-87 34.018249999999995 35.0 34.0 36.0 31.5 37.0 88-89 33.8755 35.0 34.0 35.0 31.5 36.0 90-91 33.804375 35.0 34.0 35.0 31.5 36.0 92-93 33.652875 35.0 34.0 35.0 31.5 36.0 94-95 33.614374999999995 35.0 34.0 35.0 32.0 36.0 96-97 33.184124999999995 35.0 34.0 35.0 31.0 35.0 98-99 33.145 35.0 34.0 35.0 31.0 35.0 100 32.9995 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.10163419233186488 1101 2 -0.051414204902577865 1101 3 -0.004714016341921479 1101 4 -0.01659333752356673 1101 5 0.0011942174732908484 1101 6 0.09446888749214821 1101 7 0.027215587680707642 1101 8 0.019358893777493336 1101 9 -0.045694531741041544 1101 10-11 0.05905091137649521 1101 12-13 0.04010056568196774 1101 14-15 0.1572595851665639 1101 16-17 -0.061847894406035664 1101 18-19 0.0392206159648012 1101 20-21 -0.0056882463859224686 1101 22-23 -0.04695160276555299 1101 24-25 -0.081395348837205 1101 26-27 -0.0037083595223137422 1101 28-29 -0.018856065367700126 1101 30-31 0.3405405405405446 1101 32-33 -0.13456945317410884 1101 34-35 0.08978629792583348 1101 36-37 -0.08331238214958603 1101 38-39 -0.2674418604651194 1101 40-41 -0.08922061596480546 1101 42-43 0.057479572595852346 1101 44-45 0.04041483343808494 1101 46-47 0.01907605279698288 1101 48-49 -0.1022627278441206 1101 50-51 0.1180389692017556 1101 52-53 -0.10301697045883174 1101 54-55 -0.5137649277184124 1101 56-57 -0.37284726587052575 1101 58-59 -0.25873664362036664 1101 60-61 -0.26451917033312355 1101 62-63 -0.2107165304839782 1101 64-65 -0.18073538654934396 1101 66-67 -0.39066624764299007 1101 68-69 -0.24971715901948244 1101 70-71 -0.21024512884977753 1101 72-73 0.027844123192963366 1101 74-75 -0.08670647391577546 1101 76-77 0.08425518541797317 1101 78-79 0.02702702702702453 1101 80-81 0.08830923947203217 1101 82-83 0.05725958516656249 1101 84-85 -0.05408548082967002 1101 86-87 0.04503456945317197 1101 88-89 -0.10644248900062792 1101 90-91 0.012036455059707407 1101 92-93 -0.11722187303582388 1101 94-95 -0.08526084223758801 1101 96-97 -0.23884349465744492 1101 98-99 -0.20474544311753107 1101 100 -0.12218730358265617 1106 1 0.10163419233186488 1106 2 0.051414204902577865 1106 3 0.004714016341928584 1106 4 0.016593337523573837 1106 5 -0.001194217473283743 1106 6 -0.09446888749214111 1106 7 -0.027215587680700537 1106 8 -0.01935889377750044 1106 9 0.045694531741041544 1106 10-11 -0.0590509113764881 1106 12-13 -0.04010056568196063 1106 14-15 -0.1572595851665639 1106 16-17 0.061847894406035664 1106 18-19 -0.0392206159648012 1106 20-21 0.005688246385915363 1106 22-23 0.046951602765560096 1106 24-25 0.08139534883721211 1106 26-27 0.0037083595223137422 1106 28-29 0.01885606536769302 1106 30-31 -0.3405405405405446 1106 32-33 0.13456945317410884 1106 34-35 -0.08978629792583348 1106 36-37 0.08331238214959313 1106 38-39 0.2674418604651194 1106 40-41 0.08922061596479836 1106 42-43 -0.057479572595852346 1106 44-45 -0.040414833438092046 1106 46-47 -0.019076052796989984 1106 48-49 0.1022627278441206 1106 50-51 -0.11803896920176271 1106 52-53 0.10301697045883174 1106 54-55 0.5137649277184124 1106 56-57 0.37284726587052575 1106 58-59 0.25873664362036664 1106 60-61 0.26451917033312355 1106 62-63 0.2107165304839711 1106 64-65 0.18073538654934396 1106 66-67 0.39066624764299007 1106 68-69 0.24971715901948244 1106 70-71 0.21024512884978463 1106 72-73 -0.02784412319295626 1106 74-75 0.08670647391577546 1106 76-77 -0.08425518541797317 1106 78-79 -0.02702702702702453 1106 80-81 -0.08830923947203217 1106 82-83 -0.05725958516656249 1106 84-85 0.05408548082967002 1106 86-87 -0.045034569453179074 1106 88-89 0.10644248900062792 1106 90-91 -0.012036455059707407 1106 92-93 0.11722187303582388 1106 94-95 0.08526084223758801 1106 96-97 0.23884349465745203 1106 98-99 0.20474544311753107 1106 100 0.12218730358264906 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 2.0 17 0.0 18 1.0 19 2.0 20 2.0 21 7.0 22 7.0 23 4.0 24 7.0 25 9.0 26 7.0 27 15.0 28 22.0 29 30.0 30 30.0 31 32.0 32 50.0 33 76.0 34 89.0 35 166.0 36 288.0 37 869.0 38 1757.0 39 525.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.21608040201005 15.77889447236181 18.366834170854272 42.63819095477387 2 21.75 23.05 35.275 19.925 3 22.125 28.625 25.224999999999998 24.025 4 23.45 33.85 21.075 21.625 5 23.724999999999998 35.449999999999996 22.775000000000002 18.05 6 18.4 39.6 23.7 18.3 7 16.375 18.475 45.275 19.875 8 17.65 24.75 29.049999999999997 28.549999999999997 9 20.025000000000002 24.224999999999998 31.974999999999998 23.775 10-11 22.35 33.637499999999996 22.325 21.6875 12-13 19.7375 27.575 30.062499999999996 22.625 14-15 20.7625 28.425 28.537499999999998 22.275 16-17 21.65 27.5125 28.7 22.1375 18-19 20.5625 29.512500000000003 27.987499999999997 21.9375 20-21 21.475 29.012500000000003 27.650000000000002 21.8625 22-23 20.7375 29.125 28.525 21.6125 24-25 21.075 28.725 27.675 22.525000000000002 26-27 21.0125 30.225 27.6 21.1625 28-29 21.425 29.1125 27.275 22.1875 30-31 21.0125 28.3625 29.1375 21.4875 32-33 21.575 29.625 27.3375 21.462500000000002 34-35 20.5625 29.762499999999996 28.4125 21.2625 36-37 21.5625 29.1375 27.975 21.325 38-39 21.125 29.65 27.437499999999996 21.7875 40-41 21.675 29.95 28.012500000000003 20.3625 42-43 21.7875 28.9 28.125 21.1875 44-45 21.8 28.275 28.1625 21.762500000000003 46-47 21.95 29.175 27.200000000000003 21.675 48-49 20.599999999999998 30.0875 27.3375 21.975 50-51 21.175 28.8375 28.012500000000003 21.975 52-53 20.65 28.5875 28.999999999999996 21.762500000000003 54-55 20.8875 29.4125 28.8375 20.8625 56-57 21.337500000000002 28.1625 28.487499999999997 22.0125 58-59 20.5 29.6625 27.575 22.2625 60-61 20.349999999999998 29.8875 28.775000000000002 20.9875 62-63 20.200000000000003 28.95 28.6125 22.237499999999997 64-65 22.4625 28.1625 28.199999999999996 21.175 66-67 21.1125 28.012500000000003 28.725 22.15 68-69 21.6625 28.537499999999998 28.3375 21.462500000000002 70-71 21.462500000000002 28.787499999999998 28.6375 21.1125 72-73 20.8875 29.625 28.599999999999998 20.8875 74-75 20.45 29.1625 28.95 21.4375 76-77 21.475 28.1375 29.4 20.9875 78-79 20.75 29.025000000000002 28.8875 21.337500000000002 80-81 21.65 29.4375 27.6875 21.224999999999998 82-83 21.3625 28.599999999999998 28.1625 21.875 84-85 22.175 29.262500000000003 28.050000000000004 20.5125 86-87 21.0 29.362500000000004 27.725 21.912499999999998 88-89 22.2625 28.349999999999998 28.000000000000004 21.3875 90-91 21.2875 29.5 28.825 20.3875 92-93 21.3125 28.762500000000003 28.762500000000003 21.1625 94-95 21.087500000000002 28.050000000000004 29.225 21.637500000000003 96-97 21.6625 28.812500000000004 28.925 20.599999999999998 98-99 21.425 29.2375 28.475 20.8625 100 22.5 29.4 27.800000000000004 20.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 4.0 26 7.5 27 15.5 28 17.5 29 17.0 30 21.5 31 30.5 32 45.5 33 59.0 34 73.0 35 107.5 36 138.0 37 144.0 38 164.5 39 187.0 40 220.0 41 251.5 42 263.0 43 265.0 44 263.5 45 249.5 46 222.5 47 214.0 48 200.5 49 176.0 50 145.0 51 118.0 52 88.5 53 60.0 54 46.5 55 36.5 56 29.5 57 24.5 58 18.5 59 14.5 60 12.5 61 10.5 62 8.0 63 5.0 64 4.5 65 3.5 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673500 spots for SRR3241536.sra Written 673500 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra Read 673485 spots for SRR3241536.sra Written 673485 spots for SRR3241536.sra SRR ids: ['SRR3241536.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iu176u03 SRR3241536.sra spots: 13469715 blocks: [[1, 673485], [673486, 1346970], [1346971, 2020455], [2020456, 2693940], [2693941, 3367425], [3367426, 4040910], [4040911, 4714395], [4714396, 5387880], [5387881, 6061365], [6061366, 6734850], [6734851, 7408335], [7408336, 8081820], [8081821, 8755305], [8755306, 9428790], [9428791, 10102275], [10102276, 10775760], [10775761, 11449245], [11449246, 12122730], [12122731, 12796215], [12796216, 13469715]] SRR3241536 file size 3507653 SRR3241536 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241536 SRR3241536_1.fastq Input file: SRR3241536_1.fastq trimmed: SRR3241536-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:44:42 2025 >> started Mon Feb 10 15:44:49 2025 >> done (6.869s) 13469715 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 13469715 (100.00%) reads available; of these: 547655 ( 4.07%) trimmed reads available after processing 12922060 (95.93%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 51 1101 0.01% 52 1532 0.01% 53 2019 0.01% 54 2400 0.02% 55 2689 0.02% 56 2985 0.02% 57 3198 0.02% 58 3499 0.03% 59 3701 0.03% 60 3921 0.03% 61 3870 0.03% 62 3986 0.03% 63 4017 0.03% 64 4332 0.03% 65 4446 0.03% 66 4531 0.03% 67 4824 0.04% 68 4829 0.04% 69 5177 0.04% 70 5304 0.04% 71 5496 0.04% 72 5778 0.04% 73 6091 0.05% 74 6534 0.05% 75 6560 0.05% 76 4048 0.03% 77 4743 0.04% 78 5362 0.04% 79 6023 0.04% 80 6423 0.05% 81 7006 0.05% 82 7436 0.06% 83 7702 0.06% 84 8503 0.06% 85 9275 0.07% 86 9727 0.07% 87 10460 0.08% 88 11490 0.09% 89 12722 0.09% 90 13995 0.10% 91 16090 0.12% 92 18185 0.14% 93 21172 0.16% 94 25526 0.19% 95 29528 0.22% 96 36207 0.27% 97 48690 0.36% 98 64056 0.48% 99 60466 0.45% 100 12922060 95.93% 13469715 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=26 prefix-density=0.10 prefix-fanout=3.7 sequence=CAAGGTGGGTACAACCAACAAGAGCACAGGGGCGGCGCACAAGGTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=236.29 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=21.9 sequence=AAAAGAAAAGAAAA Started job on | Feb 10 15:45:19 Started mapping on | Feb 10 15:45:19 Finished on | Feb 10 15:45:33 Mapping speed, Million of reads per hour | 3463.64 Number of input reads | 13469715 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13057640 Uniquely mapped reads % | 96.94% Average mapped length | 99.21 Number of splices: Total | 3246321 Number of splices: Annotated (sjdb) | 3164178 Number of splices: GT/AG | 3191052 Number of splices: GC/AG | 44878 Number of splices: AT/AC | 3231 Number of splices: Non-canonical | 7160 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.07 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271902 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 74373 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 140173 140173 140173 N_multimapping 271902 271902 271902 N_noFeature 735719 6793938 6898452 N_ambiguous 151596 25578 25580 UnstrandedReadsAssigned:12170325 PositiveStrandReadsAssigned:6238124 NegativeStrandReadsAssigned:6133608 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241536 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241536-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,469,715 reads, 12,423,583 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52401 SRR3241536.ke.tsv 34699 SRR3241536.se.tsv 87100 total ==> SRR3241536.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1248 67.3855 Potri.005G024800.1.v4.1 1035 936 1571 173.911 Potri.004G059700.1.v4.1 961 862 27 3.24551 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 398.673 14.5249 Potri.016G087400.1.v4.1 270 171 211 127.854 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 68 4.20902 Potri.012G127500.1.v4.1 977 878 3237 382.01 ==> SRR3241536.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 279 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 492 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 32 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR3241536 completed mapping pipeline successfully