Starting /dee2/code/volunteer_pipeline.sh SRR3241537 current disk space = 3058496950272 free memory = 1532618964 SRR3241537 SRAfilesize a35c16799b04e44e22ac11e401702379 SRR3241537.sra SRR3241537.sra file validated SRR3241537 is single end SRR3241537 is conventional basespace SRR3241537 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241537_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92875 34.0 33.0 34.0 31.0 34.0 2 33.102 34.0 34.0 34.0 31.0 34.0 3 33.24775 34.0 34.0 34.0 31.0 34.0 4 36.554 37.0 37.0 37.0 35.0 37.0 5 36.53025 37.0 37.0 37.0 35.0 37.0 6 36.5175 37.0 37.0 37.0 35.0 37.0 7 36.472 37.0 37.0 37.0 35.0 37.0 8 36.46675 37.0 37.0 37.0 35.0 37.0 9 38.341 39.0 39.0 39.0 37.0 39.0 10-11 38.304875 39.0 39.0 39.0 37.0 39.0 12-13 38.198125000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.896874999999994 41.0 40.0 41.0 38.0 41.0 16-17 39.869749999999996 41.0 40.0 41.0 38.0 41.0 18-19 39.88075 41.0 40.0 41.0 38.0 41.0 20-21 39.805625 41.0 40.0 41.0 38.0 41.0 22-23 39.706875 41.0 40.0 41.0 37.5 41.0 24-25 39.7 41.0 40.0 41.0 37.5 41.0 26-27 39.56875 41.0 40.0 41.0 37.0 41.0 28-29 39.5245 41.0 40.0 41.0 37.0 41.0 30-31 39.448 41.0 39.0 41.0 37.0 41.0 32-33 39.201499999999996 40.0 39.0 41.0 36.0 41.0 34-35 39.194125 40.0 39.0 41.0 36.0 41.0 36-37 39.3995 41.0 39.0 41.0 37.0 41.0 38-39 39.181250000000006 41.0 39.0 41.0 35.5 41.0 40-41 39.45025 41.0 40.0 41.0 36.0 41.0 42-43 39.548 41.0 40.0 41.0 37.0 41.0 44-45 39.408249999999995 41.0 40.0 41.0 36.0 41.0 46-47 39.39425 41.0 39.0 41.0 36.0 41.0 48-49 39.265 41.0 39.0 41.0 35.5 41.0 50-51 39.205124999999995 41.0 39.0 41.0 35.0 41.0 52-53 38.985125 40.5 39.0 41.0 35.0 41.0 54-55 38.56425 40.0 38.0 41.0 34.0 41.0 56-57 38.40025 40.0 38.0 41.0 34.0 41.0 58-59 38.493624999999994 40.0 37.5 41.0 34.0 41.0 60-61 38.378625 40.0 37.0 41.0 34.0 41.0 62-63 37.9315 39.5 36.5 41.0 34.0 41.0 64-65 37.753375 39.0 36.0 41.0 34.0 41.0 66-67 37.43675 39.0 35.5 41.0 33.0 41.0 68-69 37.192875 38.5 35.0 40.0 34.0 41.0 70-71 36.764375 37.0 35.0 40.0 33.0 41.0 72-73 36.336 37.0 35.0 39.0 33.0 41.0 74-75 35.93962500000001 36.0 35.0 39.0 33.0 40.5 76-77 34.602000000000004 35.0 33.5 37.0 30.5 39.0 78-79 35.0265 35.0 34.5 37.0 32.0 39.0 80-81 34.817125000000004 35.0 35.0 37.0 32.0 39.0 82-83 34.491749999999996 35.0 35.0 36.0 31.5 37.0 84-85 34.20099999999999 35.0 34.0 36.0 31.0 37.0 86-87 34.00087499999999 35.0 34.0 36.0 31.5 37.0 88-89 33.837 35.0 34.0 35.0 31.0 36.0 90-91 33.671625 35.0 34.0 35.0 31.0 36.0 92-93 33.462875 35.0 34.0 35.0 31.0 36.0 94-95 33.337375 35.0 34.0 35.0 31.0 36.0 96-97 32.992000000000004 35.0 34.0 35.0 30.0 35.5 98-99 32.845375000000004 35.0 34.0 35.0 30.0 35.0 100 32.81425 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.1303543297241916 1101 2 -0.048698457152859476 1101 3 0.025793303493287567 1101 4 -0.031106999074793862 1101 5 -0.02379285339200976 1101 6 -0.03050686404441194 1101 7 0.036083118701711214 1101 8 -0.07811757645470152 1101 9 -0.031157010327319767 1101 10-11 1.1252531819394562E-4 1101 12-13 -0.034964116926303745 1101 14-15 0.03708959515891053 1101 16-17 0.07244129929234333 1101 18-19 0.018429146557970455 1101 20-21 -0.13387387162111963 1101 22-23 0.05013002925658583 1101 24-25 0.09297716986321802 1101 26-27 -0.09437123352753929 1101 28-29 -0.0740166537470941 1101 30-31 -0.06386436948313445 1101 32-33 0.05187417168862396 1101 34-35 -0.057662974169190306 1101 36-37 -0.0719724437998579 1101 38-39 -0.455552499312347 1101 40-41 -0.2486872046210422 1101 42-43 0.015465979845465938 1101 44-45 -0.10276062113975826 1101 46-47 -0.17994673801604932 1101 48-49 -0.10685529244079817 1101 50-51 -0.2923032682353508 1101 52-53 -0.19681303293241115 1101 54-55 -0.48270860943711824 1101 56-57 -0.443843614813332 1101 58-59 -0.12479057788002734 1101 60-61 -0.2681353304493541 1101 62-63 -0.23115826060863753 1101 64-65 -0.006432697356906658 1101 66-67 -0.07190992973418986 1101 68-69 -0.09817208871996286 1101 70-71 -0.10918081568352989 1101 72-73 -0.14043159710934816 1101 74-75 -0.2634905353704582 1101 76-77 -0.2799567402665559 1101 78-79 -0.2847515691030509 1101 80-81 -0.09799704933610087 1101 82-83 0.005588757470427197 1101 84-85 0.10407341651871604 1101 86-87 -0.06113875622015286 1101 88-89 -0.3588744967617643 1101 90-91 -0.3490535370458332 1101 92-93 -0.2927971293541063 1101 94-95 -0.3351504088419901 1101 96-97 -0.3249356105123624 1101 98-99 -0.49388612437797974 1101 100 -0.4292590832937364 1104 1 0.13035432972418448 1104 2 0.048698457152859476 1104 3 -0.025793303493287567 1104 4 0.031106999074786756 1104 5 0.023792853392016866 1104 6 0.030506864044404836 1104 7 -0.03608311870170411 1104 8 0.07811757645470152 1104 9 0.031157010327326873 1104 10-11 -1.1252531819394562E-4 1104 12-13 0.03496411692631085 1104 14-15 -0.03708959515891053 1104 16-17 -0.07244129929234333 1104 18-19 -0.018429146557970455 1104 20-21 0.13387387162111963 1104 22-23 -0.05013002925658583 1104 24-25 -0.09297716986322513 1104 26-27 0.09437123352753929 1104 28-29 0.07401665374708699 1104 30-31 0.06386436948313445 1104 32-33 -0.051874171688631066 1104 34-35 0.057662974169190306 1104 36-37 0.0719724437998508 1104 38-39 0.455552499312347 1104 40-41 0.2486872046210351 1104 42-43 -0.015465979845465938 1104 44-45 0.10276062113975826 1104 46-47 0.17994673801605643 1104 48-49 0.10685529244079817 1104 50-51 0.2923032682353579 1104 52-53 0.19681303293240404 1104 54-55 0.48270860943712535 1104 56-57 0.443843614813332 1104 58-59 0.12479057788002024 1104 60-61 0.2681353304493541 1104 62-63 0.23115826060863043 1104 64-65 0.006432697356906658 1104 66-67 0.07190992973418986 1104 68-69 0.09817208871996286 1104 70-71 0.10918081568352278 1104 72-73 0.14043159710934816 1104 74-75 0.2634905353704582 1104 76-77 0.27995674026656303 1104 78-79 0.2847515691030509 1104 80-81 0.09799704933610087 1104 82-83 -0.005588757470427197 1104 84-85 -0.10407341651871604 1104 86-87 0.06113875622014575 1104 88-89 0.3588744967617714 1104 90-91 0.3490535370458403 1104 92-93 0.2927971293541063 1104 94-95 0.3351504088419901 1104 96-97 0.3249356105123624 1104 98-99 0.49388612437798685 1104 100 0.4292590832937435 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 5.0 19 2.0 20 5.0 21 3.0 22 6.0 23 6.0 24 9.0 25 13.0 26 15.0 27 11.0 28 18.0 29 23.0 30 32.0 31 62.0 32 51.0 33 91.0 34 115.0 35 182.0 36 319.0 37 803.0 38 1722.0 39 503.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.211853720050442 15.006305170239598 18.335435056746533 42.44640605296343 2 20.7 22.425 36.15 20.724999999999998 3 23.05 26.125 26.0 24.825 4 24.75 31.974999999999998 19.625 23.65 5 26.05 34.475 22.35 17.125 6 18.9 39.375 22.825 18.9 7 17.599999999999998 18.55 43.275000000000006 20.575 8 19.6 23.925 29.25 27.224999999999998 9 20.849999999999998 22.95 31.75 24.45 10-11 21.85 34.1 23.775 20.275000000000002 12-13 19.787499999999998 27.55 30.312499999999996 22.35 14-15 20.75 28.449999999999996 28.7 22.1 16-17 21.349999999999998 28.237499999999997 28.462500000000002 21.95 18-19 21.7875 29.212500000000002 27.1125 21.8875 20-21 21.125 29.7 27.450000000000003 21.725 22-23 21.325 29.075 27.825 21.775 24-25 21.95 29.2875 27.3875 21.375 26-27 21.1125 29.599999999999998 27.6625 21.625 28-29 21.7375 28.5625 27.650000000000002 22.05 30-31 21.512500000000003 29.7 27.725 21.0625 32-33 21.075 29.912499999999998 27.3625 21.65 34-35 20.775 29.75 27.987499999999997 21.4875 36-37 22.3625 28.075 27.737499999999997 21.825 38-39 21.512500000000003 29.175 27.400000000000002 21.912499999999998 40-41 21.3125 30.25 27.325 21.1125 42-43 21.3875 29.012500000000003 28.425 21.175 44-45 22.0625 29.375 27.425 21.1375 46-47 22.0625 28.6625 27.6375 21.637500000000003 48-49 21.987499999999997 28.449999999999996 27.3625 22.2 50-51 22.0625 28.299999999999997 27.9125 21.725 52-53 21.7 29.2 27.525 21.575 54-55 21.7375 28.975 28.3875 20.9 56-57 21.5625 29.012500000000003 27.700000000000003 21.725 58-59 22.0125 28.625 28.275 21.087500000000002 60-61 20.8125 28.749999999999996 28.449999999999996 21.987499999999997 62-63 21.275 28.4 28.812500000000004 21.512500000000003 64-65 21.6 28.8625 27.5625 21.975 66-67 21.762500000000003 28.787499999999998 27.925 21.525 68-69 21.325 28.225 28.975 21.475 70-71 20.9125 27.6875 28.8625 22.537499999999998 72-73 21.625 28.449999999999996 28.725 21.2 74-75 22.15 28.5875 27.800000000000004 21.462500000000002 76-77 21.6625 29.049999999999997 28.5875 20.7 78-79 21.65 28.249999999999996 28.1875 21.912499999999998 80-81 21.0125 29.462500000000002 28.025 21.5 82-83 21.212500000000002 28.5625 28.712500000000002 21.512500000000003 84-85 20.9875 28.4125 28.825 21.775 86-87 21.55 27.975 28.212500000000002 22.2625 88-89 21.349999999999998 29.15 28.625 20.875 90-91 21.325 28.7 28.525 21.45 92-93 22.25 27.625 28.625 21.5 94-95 21.512500000000003 28.8625 28.212500000000002 21.4125 96-97 20.65 29.1625 27.950000000000003 22.237499999999997 98-99 21.0 28.262500000000003 28.325 22.412499999999998 100 21.85 28.599999999999998 29.075 20.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 3.0 24 5.5 25 8.0 26 9.0 27 9.5 28 13.0 29 20.5 30 38.0 31 48.5 32 52.5 33 59.5 34 74.0 35 104.5 36 124.5 37 135.0 38 167.5 39 198.0 40 218.0 41 231.0 42 224.5 43 229.0 44 224.5 45 226.5 46 232.5 47 220.0 48 199.0 49 161.5 50 135.5 51 112.0 52 96.0 53 79.0 54 58.5 55 50.0 56 35.5 57 29.0 58 26.5 59 21.5 60 21.0 61 17.5 62 14.5 63 10.5 64 8.0 65 7.5 66 4.0 67 5.0 68 6.5 69 6.0 70 4.0 71 1.0 72 0.5 73 1.0 74 1.5 75 2.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961713 spots for SRR3241537.sra Written 961713 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra Read 961700 spots for SRR3241537.sra Written 961700 spots for SRR3241537.sra SRR ids: ['SRR3241537.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rpi2th6r SRR3241537.sra spots: 19234013 blocks: [[1, 961700], [961701, 1923400], [1923401, 2885100], [2885101, 3846800], [3846801, 4808500], [4808501, 5770200], [5770201, 6731900], [6731901, 7693600], [7693601, 8655300], [8655301, 9617000], [9617001, 10578700], [10578701, 11540400], [11540401, 12502100], [12502101, 13463800], [13463801, 14425500], [14425501, 15387200], [15387201, 16348900], [16348901, 17310600], [17310601, 18272300], [18272301, 19234013]] SRR3241537 file size 5013383 SRR3241537 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241537 SRR3241537_1.fastq Input file: SRR3241537_1.fastq trimmed: SRR3241537-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:39:18 2025 >> started Mon Feb 10 16:39:33 2025 >> done (14.999s) 19234013 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 19234013 (100.00%) reads available; of these: 844152 ( 4.39%) trimmed reads available after processing 18389861 (95.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 51 2063 0.01% 52 2610 0.01% 53 3483 0.02% 54 4041 0.02% 55 4510 0.02% 56 5116 0.03% 57 5241 0.03% 58 5646 0.03% 59 5936 0.03% 60 6228 0.03% 61 6262 0.03% 62 6356 0.03% 63 6574 0.03% 64 6745 0.04% 65 7363 0.04% 66 7274 0.04% 67 7983 0.04% 68 7923 0.04% 69 7965 0.04% 70 8630 0.04% 71 8972 0.05% 72 9360 0.05% 73 9820 0.05% 74 10340 0.05% 75 10892 0.06% 76 6342 0.03% 77 7422 0.04% 78 8443 0.04% 79 9181 0.05% 80 10270 0.05% 81 10821 0.06% 82 11631 0.06% 83 12222 0.06% 84 13222 0.07% 85 14560 0.08% 86 15375 0.08% 87 16491 0.09% 88 18014 0.09% 89 20003 0.10% 90 21245 0.11% 91 24628 0.13% 92 27967 0.15% 93 32824 0.17% 94 38745 0.20% 95 44865 0.23% 96 54392 0.28% 97 73505 0.38% 98 95595 0.50% 99 89056 0.46% 100 18389861 95.61% 19234013 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=32 prefix-density=0.13 prefix-fanout=1.9 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=105.61 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=16.4 sequence=TTTTTCTTTTTC Started job on | Feb 10 16:39:56 Started mapping on | Feb 10 16:39:56 Finished on | Feb 10 16:40:22 Mapping speed, Million of reads per hour | 2663.17 Number of input reads | 19234013 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 17040218 Uniquely mapped reads % | 88.59% Average mapped length | 99.20 Number of splices: Total | 3959404 Number of splices: Annotated (sjdb) | 3849563 Number of splices: GT/AG | 3891140 Number of splices: GC/AG | 55241 Number of splices: AT/AC | 3788 Number of splices: Non-canonical | 9235 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 451037 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 1626064 % of reads mapped to too many loci | 8.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.60% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1742758 1742758 1742758 N_multimapping 451037 451037 451037 N_noFeature 1057267 8913747 9046855 N_ambiguous 202719 33239 33227 UnstrandedReadsAssigned:15780232 PositiveStrandReadsAssigned:8093232 NegativeStrandReadsAssigned:7960136 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241537 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241537-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,234,013 reads, 17,492,561 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR3241537.ke.tsv 34699 SRR3241537.se.tsv 87100 total ==> SRR3241537.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1731 64.6555 Potri.005G024800.1.v4.1 1035 936 2330 178.428 Potri.004G059700.1.v4.1 961 862 3 0.249458 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 593.833 14.9664 Potri.016G087400.1.v4.1 270 171 288 120.72 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 251 10.7474 Potri.012G127500.1.v4.1 977 878 6148 501.906 ==> SRR3241537.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 55 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 519 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 31 SRR3241537 completed mapping pipeline successfully