Starting /dee2/code/volunteer_pipeline.sh SRR3241538 current disk space = 3058655526912 free memory = 744187140 SRR3241538 SRAfilesize 75b5cf7bde51714de6ae5e6e53623843 SRR3241538.sra SRR3241538.sra file validated SRR3241538 is single end SRR3241538 is conventional basespace SRR3241538 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3241538_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96875 34.0 33.0 34.0 31.0 34.0 2 33.1995 34.0 34.0 34.0 31.0 34.0 3 33.2915 34.0 34.0 34.0 31.0 34.0 4 36.5625 37.0 37.0 37.0 35.0 37.0 5 36.592 37.0 37.0 37.0 35.0 37.0 6 36.4665 37.0 37.0 37.0 35.0 37.0 7 36.51075 37.0 37.0 37.0 35.0 37.0 8 36.515 37.0 37.0 37.0 35.0 37.0 9 38.38225 39.0 39.0 39.0 37.0 39.0 10-11 38.38275 39.0 39.0 39.0 37.0 39.0 12-13 38.31775 39.0 39.0 39.0 37.0 39.0 14-15 39.967625 41.0 40.0 41.0 38.0 41.0 16-17 39.950625 41.0 40.0 41.0 38.0 41.0 18-19 39.952124999999995 41.0 40.0 41.0 38.0 41.0 20-21 39.78575 41.0 40.0 41.0 38.0 41.0 22-23 39.849374999999995 41.0 40.0 41.0 38.0 41.0 24-25 39.874625 41.0 40.0 41.0 38.0 41.0 26-27 39.634625 41.0 40.0 41.0 37.0 41.0 28-29 39.679500000000004 41.0 40.0 41.0 37.5 41.0 30-31 39.577375 41.0 40.0 41.0 37.0 41.0 32-33 39.40725 41.0 39.0 41.0 37.0 41.0 34-35 39.388125 40.5 39.0 41.0 36.5 41.0 36-37 39.603125 41.0 40.0 41.0 37.5 41.0 38-39 39.50325 41.0 40.0 41.0 37.0 41.0 40-41 39.691125 41.0 40.0 41.0 37.0 41.0 42-43 39.6635 41.0 40.0 41.0 37.0 41.0 44-45 39.493 41.0 40.0 41.0 37.0 41.0 46-47 39.655375 41.0 40.0 41.0 37.0 41.0 48-49 39.504999999999995 41.0 40.0 41.0 36.5 41.0 50-51 39.48524999999999 41.0 39.5 41.0 36.5 41.0 52-53 39.34425 41.0 39.0 41.0 36.0 41.0 54-55 38.936625 40.5 39.0 41.0 35.0 41.0 56-57 38.7615 40.0 38.5 41.0 34.5 41.0 58-59 38.938 40.0 38.5 41.0 35.0 41.0 60-61 38.714875 40.0 38.0 41.0 35.0 41.0 62-63 38.438 40.0 37.0 41.0 34.5 41.0 64-65 38.2365 39.5 37.0 41.0 34.5 41.0 66-67 37.80925 39.0 36.0 41.0 34.0 41.0 68-69 37.6275 39.0 36.0 40.5 34.0 41.0 70-71 37.158500000000004 37.5 35.0 40.0 34.0 41.0 72-73 36.769999999999996 37.0 35.0 39.0 34.0 41.0 74-75 36.3315 37.0 35.0 39.0 33.5 40.5 76-77 34.884125 35.0 33.5 37.0 31.0 39.0 78-79 35.40875 36.0 35.0 37.0 32.5 39.0 80-81 35.137249999999995 35.0 35.0 37.0 33.0 39.0 82-83 34.896625 35.0 35.0 36.5 33.0 37.5 84-85 34.464375000000004 35.0 34.5 36.0 32.0 37.0 86-87 34.293125 35.0 35.0 36.0 32.0 37.0 88-89 34.027249999999995 35.0 34.5 35.0 31.5 36.0 90-91 33.954625 35.0 34.0 35.0 32.0 36.0 92-93 33.842124999999996 35.0 34.0 35.0 32.0 36.0 94-95 33.809 35.0 34.0 35.0 32.0 36.0 96-97 33.489875 35.0 34.0 35.0 31.0 35.5 98-99 33.357749999999996 35.0 34.0 35.0 31.0 35.0 100 33.297 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.16563726838538884 1101 2 0.1807031582105978 1101 3 0.09052036708258981 1101 4 0.06258908254357465 1101 5 0.06608987022080015 1101 6 0.16166137380910328 1101 7 0.11902678102573105 1101 8 0.02923157710484503 1101 9 0.13739341351804057 1101 10-11 0.17546447950789457 1101 12-13 -0.021067240129028164 1101 14-15 0.006501462829135107 1101 16-17 -0.009439623915383777 1101 18-19 0.08279362856642791 1101 20-21 0.12969793203470914 1101 22-23 -0.016434947863274374 1101 24-25 0.0575692030706918 1101 26-27 0.19493761096246232 1101 28-29 0.1322672601335313 1101 30-31 0.23108949513640908 1101 32-33 0.07305393713585318 1101 34-35 0.17140731664624553 1101 36-37 0.13868745467730292 1101 38-39 -0.11088119826961673 1101 40-41 0.061657622965164194 1101 42-43 0.26442824635542905 1101 44-45 0.07928033807606738 1101 46-47 0.12289640169038307 1101 48-49 0.20012627841264674 1101 50-51 0.014003150708909118 1101 52-53 -0.044503763346753544 1101 54-55 -0.2103285739291323 1101 56-57 -0.12947288139831414 1101 58-59 -0.14397614463253916 1101 60-61 0.1372183741341786 1101 62-63 0.1291353054437252 1101 64-65 0.21559225825811268 1101 66-67 -0.09670925958340604 1101 68-69 0.061388812482810806 1101 70-71 0.09822835137905628 1101 72-73 0.11160011002476011 1101 74-75 0.07781750893951056 1101 76-77 0.183022430046762 1101 78-79 0.13391763146707802 1101 80-81 0.11094371233527767 1101 82-83 -0.03350753919631444 1101 84-85 -0.002575579505389669 1101 86-87 0.06115125903328078 1101 88-89 0.3148458403140708 1101 90-91 0.04372233752594212 1101 92-93 -0.1392688354879894 1101 94-95 -0.22384411492586054 1101 96-97 -0.18799229826711183 1101 98-99 -0.4590157785501745 1101 100 -0.4121302293015887 1106 1 -0.16563726838538884 1106 2 -0.1807031582105978 1106 3 -0.09052036708259692 1106 4 -0.06258908254356754 1106 5 -0.06608987022080015 1106 6 -0.1616613738091104 1106 7 -0.11902678102572395 1106 8 -0.029231577104852136 1106 9 -0.13739341351804768 1106 10-11 -0.17546447950788746 1106 12-13 0.021067240129028164 1106 14-15 -0.006501462829142213 1106 16-17 0.009439623915383777 1106 18-19 -0.08279362856642791 1106 20-21 -0.12969793203470203 1106 22-23 0.01643494786326727 1106 24-25 -0.0575692030706918 1106 26-27 -0.19493761096246942 1106 28-29 -0.1322672601335313 1106 30-31 -0.23108949513640198 1106 32-33 -0.07305393713585318 1106 34-35 -0.17140731664624553 1106 36-37 -0.13868745467730292 1106 38-39 0.11088119826960963 1106 40-41 -0.0616576229651713 1106 42-43 -0.26442824635542905 1106 44-45 -0.07928033807606738 1106 46-47 -0.12289640169037597 1106 48-49 -0.20012627841264674 1106 50-51 -0.014003150708909118 1106 52-53 0.044503763346753544 1106 54-55 0.2103285739291394 1106 56-57 0.12947288139831414 1106 58-59 0.14397614463254627 1106 60-61 -0.1372183741341786 1106 62-63 -0.1291353054437252 1106 64-65 -0.21559225825811268 1106 66-67 0.09670925958340604 1106 68-69 -0.061388812482810806 1106 70-71 -0.09822835137905628 1106 72-73 -0.11160011002475301 1106 74-75 -0.07781750893951056 1106 76-77 -0.1830224300467549 1106 78-79 -0.13391763146707802 1106 80-81 -0.11094371233527767 1106 82-83 0.03350753919631444 1106 84-85 0.002575579505389669 1106 86-87 -0.061151259033287886 1106 88-89 -0.3148458403140708 1106 90-91 -0.04372233752594923 1106 92-93 0.1392688354879823 1106 94-95 0.22384411492585343 1106 96-97 0.18799229826710473 1106 98-99 0.4590157785501674 1106 100 0.4121302293015958 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 2.0 20 2.0 21 2.0 22 4.0 23 7.0 24 8.0 25 3.0 26 11.0 27 6.0 28 12.0 29 27.0 30 36.0 31 37.0 32 57.0 33 82.0 34 102.0 35 136.0 36 280.0 37 777.0 38 1872.0 39 536.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.51168048229088 15.146948003014318 17.834714895754836 43.506656618939964 2 19.175 22.775000000000002 38.0 20.05 3 21.675 27.825 27.700000000000003 22.8 4 23.325000000000003 33.35 20.200000000000003 23.125 5 23.95 34.925 23.275000000000002 17.849999999999998 6 17.9 39.175 23.974999999999998 18.95 7 16.85 18.55 45.25 19.35 8 19.85 23.45 29.875 26.825 9 19.325 23.65 31.6 25.424999999999997 10-11 22.075 35.0125 22.900000000000002 20.0125 12-13 19.4375 26.825 31.05 22.6875 14-15 20.9875 27.700000000000003 28.975 22.3375 16-17 21.9 28.512500000000003 28.449999999999996 21.1375 18-19 21.5 28.6625 28.299999999999997 21.5375 20-21 20.724999999999998 29.1875 28.0625 22.025 22-23 20.9375 29.825000000000003 27.925 21.3125 24-25 21.05 29.012500000000003 28.025 21.912499999999998 26-27 21.1125 27.987499999999997 28.425 22.475 28-29 21.7375 28.8875 28.000000000000004 21.375 30-31 21.65 28.962500000000002 27.9375 21.45 32-33 21.4125 28.8625 28.050000000000004 21.675 34-35 21.6125 29.15 28.349999999999998 20.8875 36-37 20.9875 29.225 28.262500000000003 21.525 38-39 21.1375 27.950000000000003 28.6625 22.25 40-41 21.7375 28.65 28.175 21.4375 42-43 20.8625 29.45 28.075 21.6125 44-45 20.974999999999998 29.025000000000002 28.725 21.275 46-47 20.5125 28.3625 28.999999999999996 22.125 48-49 20.724999999999998 29.212500000000002 27.5625 22.5 50-51 21.2875 28.1375 29.2375 21.337500000000002 52-53 21.275 28.725 29.45 20.549999999999997 54-55 21.1875 29.4125 28.487499999999997 20.9125 56-57 20.962500000000002 29.2875 28.5625 21.1875 58-59 21.1625 30.1375 27.425 21.275 60-61 21.349999999999998 28.799999999999997 28.449999999999996 21.4 62-63 20.6875 28.475 28.525 22.3125 64-65 20.4875 29.15 28.775000000000002 21.587500000000002 66-67 21.2625 29.099999999999998 27.800000000000004 21.837500000000002 68-69 20.7125 28.625 29.5 21.1625 70-71 20.9875 28.5875 28.525 21.9 72-73 21.475 28.050000000000004 28.462500000000002 22.0125 74-75 21.7875 28.599999999999998 28.299999999999997 21.3125 76-77 20.9125 29.45 28.15 21.4875 78-79 21.675 28.212500000000002 28.050000000000004 22.0625 80-81 22.225 28.425 28.5875 20.7625 82-83 21.0125 29.4125 28.625 20.95 84-85 20.6375 28.449999999999996 29.1625 21.75 86-87 21.9625 28.475 29.012500000000003 20.549999999999997 88-89 21.325 29.3375 28.175 21.1625 90-91 21.45 29.5875 28.287499999999998 20.674999999999997 92-93 22.5875 29.075 28.000000000000004 20.3375 94-95 21.525 27.962500000000002 29.8375 20.674999999999997 96-97 21.512500000000003 28.8875 28.4 21.2 98-99 21.675 28.8625 29.049999999999997 20.4125 100 20.825 29.4 27.975 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 2.0 24 1.0 25 2.5 26 7.0 27 12.5 28 14.5 29 18.0 30 30.0 31 42.5 32 47.5 33 60.0 34 87.5 35 104.5 36 128.5 37 158.5 38 162.5 39 179.5 40 223.5 41 251.5 42 260.5 43 256.5 44 246.0 45 248.5 46 243.5 47 220.5 48 183.5 49 155.5 50 141.0 51 116.5 52 89.5 53 71.5 54 53.5 55 44.5 56 34.5 57 20.0 58 16.5 59 12.5 60 10.0 61 9.5 62 8.5 63 6.5 64 5.5 65 3.0 66 1.0 67 0.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657296 spots for SRR3241538.sra Written 657296 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra Read 657294 spots for SRR3241538.sra Written 657294 spots for SRR3241538.sra SRR ids: ['SRR3241538.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9f_x7k15 SRR3241538.sra spots: 13145882 blocks: [[1, 657294], [657295, 1314588], [1314589, 1971882], [1971883, 2629176], [2629177, 3286470], [3286471, 3943764], [3943765, 4601058], [4601059, 5258352], [5258353, 5915646], [5915647, 6572940], [6572941, 7230234], [7230235, 7887528], [7887529, 8544822], [8544823, 9202116], [9202117, 9859410], [9859411, 10516704], [10516705, 11173998], [11173999, 11831292], [11831293, 12488586], [12488587, 13145882]] SRR3241538 file size 3423070 SRR3241538 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3241538 SRR3241538_1.fastq Input file: SRR3241538_1.fastq trimmed: SRR3241538-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:55:16 2025 >> started Mon Feb 10 15:55:23 2025 >> done (6.439s) 13145882 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 13145882 (100.00%) reads available; of these: 508965 ( 3.87%) trimmed reads available after processing 12636917 (96.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 47 2 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1062 0.01% 52 1488 0.01% 53 1881 0.01% 54 2299 0.02% 55 2480 0.02% 56 2759 0.02% 57 3018 0.02% 58 3162 0.02% 59 3419 0.03% 60 3549 0.03% 61 3574 0.03% 62 3617 0.03% 63 3727 0.03% 64 3971 0.03% 65 3977 0.03% 66 4091 0.03% 67 4399 0.03% 68 4481 0.03% 69 4625 0.04% 70 4926 0.04% 71 5117 0.04% 72 5402 0.04% 73 5922 0.05% 74 6084 0.05% 75 6302 0.05% 76 3770 0.03% 77 4409 0.03% 78 5080 0.04% 79 5508 0.04% 80 5838 0.04% 81 6409 0.05% 82 6842 0.05% 83 7223 0.05% 84 7956 0.06% 85 8588 0.07% 86 9052 0.07% 87 9696 0.07% 88 10649 0.08% 89 11636 0.09% 90 12817 0.10% 91 15099 0.11% 92 16735 0.13% 93 19994 0.15% 94 23768 0.18% 95 27480 0.21% 96 33170 0.25% 97 45092 0.34% 98 61117 0.46% 99 55703 0.42% 100 12636917 96.13% 13145882 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=10.24 fanout-score-rank=14 prefix-density=0.26 prefix-fanout=5.8 sequence=GAAAAAGAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=214.23 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=25.4 sequence=TTCTTCTTCTTTT Started job on | Feb 10 15:55:45 Started mapping on | Feb 10 15:55:46 Finished on | Feb 10 15:55:59 Mapping speed, Million of reads per hour | 3640.40 Number of input reads | 13145882 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12660245 Uniquely mapped reads % | 96.31% Average mapped length | 99.24 Number of splices: Total | 3086318 Number of splices: Annotated (sjdb) | 3008803 Number of splices: GT/AG | 3035253 Number of splices: GC/AG | 41409 Number of splices: AT/AC | 3018 Number of splices: Non-canonical | 6638 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.24 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340863 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 76838 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 144774 144774 144774 N_multimapping 340863 340863 340863 N_noFeature 690888 6583583 6666063 N_ambiguous 146980 22928 22924 UnstrandedReadsAssigned:11822377 PositiveStrandReadsAssigned:6053734 NegativeStrandReadsAssigned:5971258 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3241538 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3241538-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,145,882 reads, 12,135,143 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,260 rounds 52401 SRR3241538.ke.tsv 34699 SRR3241538.se.tsv 87100 total ==> SRR3241538.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1843 98.1854 Potri.005G024800.1.v4.1 1035 936 9420 1028.9 Potri.004G059700.1.v4.1 961 862 21 2.49063 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 409 14.7025 Potri.016G087400.1.v4.1 270 171 306 182.945 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 397.764 24.2922 Potri.012G127500.1.v4.1 977 878 1263 147.064 ==> SRR3241538.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 434 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 35 SRR3241538 completed mapping pipeline successfully