Starting /dee2/code/volunteer_pipeline.sh SRR3317181 current disk space = 3051587842048 free memory = 1577551632 SRR3317181 SRAfilesize ade19c58d4b7c40049721cf2e19e9376 SRR3317181.sra SRR3317181.sra file validated SRR3317181 is single end SRR3317181 is conventional basespace SRR3317181 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317181_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.29675 34.0 31.0 34.0 28.0 34.0 2 31.61125 34.0 31.0 34.0 28.0 34.0 3 31.70825 34.0 31.0 34.0 28.0 34.0 4 35.187 37.0 35.0 37.0 33.0 37.0 5 35.13925 37.0 35.0 37.0 32.0 37.0 6 35.10525 37.0 35.0 37.0 33.0 37.0 7 35.0375 37.0 35.0 37.0 32.0 37.0 8 34.97725 37.0 35.0 37.0 32.0 37.0 9 36.62975 39.0 37.0 39.0 33.0 39.0 10 36.51725 39.0 37.0 39.0 32.0 39.0 11 36.428 39.0 37.0 39.0 32.0 39.0 12 36.2445 39.0 37.0 39.0 32.0 39.0 13 36.42825 39.0 37.0 39.0 32.0 39.0 14 37.835 40.0 38.0 41.0 33.0 41.0 15 37.70325 40.0 38.0 41.0 32.0 41.0 16 37.80575 40.0 38.0 41.0 33.0 41.0 17 37.685 40.0 38.0 41.0 33.0 41.0 18 37.5905 40.0 38.0 41.0 32.0 41.0 19 37.59975 40.0 38.0 41.0 32.0 41.0 20 37.644 40.0 38.0 41.0 32.0 41.0 21 37.5195 40.0 38.0 41.0 32.0 41.0 22 37.58175 40.0 38.0 41.0 32.0 41.0 23 37.4715 40.0 38.0 41.0 32.0 41.0 24 37.414 40.0 38.0 41.0 32.0 41.0 25 37.4665 40.0 38.0 41.0 32.0 41.0 26 37.5555 40.0 38.0 41.0 32.0 41.0 27 37.2745 40.0 38.0 41.0 31.0 41.0 28 37.37675 40.0 38.0 41.0 32.0 41.0 29 37.13225 40.0 38.0 41.0 31.0 41.0 30 37.15425 40.0 38.0 41.0 31.0 41.0 31 36.98325 40.0 38.0 41.0 30.0 41.0 32 37.097 40.0 38.0 41.0 31.0 41.0 33 36.85925 40.0 37.0 41.0 30.0 41.0 34 36.7405 40.0 37.0 41.0 30.0 41.0 35 36.65175 40.0 37.0 41.0 30.0 41.0 36 36.52 40.0 37.0 41.0 30.0 41.0 37 36.36125 40.0 37.0 41.0 30.0 41.0 38 36.29025 40.0 36.0 41.0 29.0 41.0 39 36.1815 40.0 37.0 41.0 29.0 41.0 40 36.27 40.0 37.0 41.0 30.0 41.0 41 36.07975 40.0 36.0 41.0 29.0 41.0 42 36.10625 40.0 36.0 41.0 29.0 41.0 43 35.75425 40.0 35.0 41.0 27.0 41.0 44 35.632 40.0 35.0 41.0 27.0 41.0 45 35.604 40.0 35.0 41.0 27.0 41.0 46 35.10575 40.0 35.0 41.0 24.0 41.0 47 35.02025 39.0 35.0 41.0 24.0 41.0 48 34.625 39.0 34.0 41.0 23.0 41.0 49 34.668 39.0 35.0 41.0 23.0 41.0 50 33.66875 38.0 33.0 40.0 18.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 72.0 3 2.0 4 6.0 5 13.0 6 6.0 7 5.0 8 4.0 9 1.0 10 8.0 11 1.0 12 4.0 13 4.0 14 1.0 15 2.0 16 6.0 17 9.0 18 8.0 19 8.0 20 10.0 21 15.0 22 21.0 23 16.0 24 15.0 25 27.0 26 24.0 27 26.0 28 28.0 29 38.0 30 58.0 31 59.0 32 59.0 33 102.0 34 126.0 35 157.0 36 220.0 37 373.0 38 642.0 39 1824.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.548460951411855 18.010684304248283 9.132536250317985 48.308318494021876 2 23.525 19.05 34.0 23.425 3 20.424999999999997 24.375 23.25 31.95 4 24.312156078039017 25.46273136568284 22.786393196598297 27.43871935967984 5 26.75 30.099999999999998 19.175 23.974999999999998 6 26.401401401401404 33.83383383383383 21.12112112112112 18.643643643643642 7 22.389181066867017 21.98847983971951 35.111445028800404 20.510894064613073 8 20.265531062124246 26.50300601202405 29.208416833667332 24.02304609218437 9 21.317635270541082 25.400801603206414 30.511022044088175 22.77054108216433 10 24.173346693386772 33.34168336673346 24.19839679358717 18.286573146292582 11 24.574148296593187 31.062124248496993 19.739478957915832 24.62424849699399 12 25.325651302605213 24.09819639278557 24.874749498997996 25.701402805611224 13 22.425457278877474 26.960661488348787 26.33425206715109 24.27962916562265 14 22.049611626158857 30.493610623903784 25.256827862691054 22.199949887246305 15 23.271543086172343 26.302605210420843 24.899799599198396 25.526052104208418 16 21.8436873747495 29.684368737474948 24.448897795591183 24.02304609218437 17 22.79559118236473 26.327655310621246 23.34669338677355 27.530060120240478 18 25.457278877474316 27.08594337258832 25.231771485843147 22.225006264094212 19 23.452768729641694 26.13380105236783 27.23628163367577 23.177148584314708 20 21.57354046604861 26.55975945878226 25.256827862691054 26.609872212478074 21 23.527937860185418 25.757955399649212 28.063142069656728 22.650964670508642 22 25.482335254322226 26.685041343021798 25.206715108995237 22.62590829366074 23 20.99724379854673 31.87171135053871 24.480080180405913 22.650964670508642 24 23.076923076923077 29.215735404660485 24.730643948884993 22.976697569531446 25 22.225006264094212 25.60761713856176 25.432222500626413 26.73515409671762 26 22.300175394637936 25.783011776497116 28.514156852919072 23.402655975945876 27 23.753445251816586 26.885492357805063 23.477825106489604 25.88323728388875 28 21.172638436482085 27.0107742420446 25.056376847907792 26.76021047356552 29 20.99724379854673 29.81708844901027 24.95615134051616 24.229516411926834 30 26.860435980957153 25.156602355299423 25.60761713856176 22.37534452518166 31 21.523427712352795 25.808068153345026 28.81483337509396 23.853670759208217 32 21.824104234527688 27.737409170633924 23.72838887496868 26.710097719869708 33 22.02455524931095 28.990228013029316 24.830869456276623 24.154347281383114 34 21.949386118767226 27.211225256827866 24.229516411926834 26.609872212478074 35 20.521172638436482 27.48684540215485 24.429967426710096 27.56201453269857 36 26.384364820846905 26.20897018291155 24.85592583312453 22.550739163117015 37 20.871961914307192 29.741919318466547 26.685041343021798 22.70107742420446 38 21.49837133550489 26.885492357805063 29.2658481583563 22.350288148333753 39 26.33425206715109 26.43447757454272 24.004009020295666 23.227261338010525 40 21.047356552242547 26.935605111500877 29.391130042595844 22.62590829366074 41 21.949386118767226 30.09270859433726 25.206715108995237 22.751190177900277 42 22.80130293159609 26.509646705086443 28.71460786770233 21.974442495615136 43 22.174893510398398 26.76021047356552 26.10874467551992 24.95615134051616 44 22.876472062139815 25.382109746930592 28.71460786770233 23.026810323227263 45 23.25231771485843 24.555249310949637 25.382109746930592 26.81032322726134 46 25.557504384865947 25.457278877474316 26.259082936607363 22.726133801052367 47 22.099724379854674 26.284139313455274 28.789776998246055 22.826359308444 48 22.775000000000002 29.125 25.674999999999997 22.425 49 22.05 26.150000000000002 28.849999999999998 22.95 50 25.3 26.424999999999997 24.425 23.849999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 1.0 6 2.0 7 1.5 8 1.0 9 1.5 10 2.0 11 1.5 12 1.0 13 1.5 14 2.0 15 1.0 16 0.0 17 1.5 18 3.0 19 2.5 20 2.0 21 3.5 22 5.0 23 9.0 24 13.0 25 14.5 26 16.0 27 22.0 28 28.0 29 36.5 30 45.0 31 64.5 32 84.0 33 105.5 34 127.0 35 146.0 36 165.0 37 190.5 38 216.0 39 246.5 40 277.0 41 300.0 42 323.0 43 331.5 44 340.0 45 354.0 46 368.0 47 345.5 48 323.0 49 395.0 50 467.0 51 370.0 52 273.0 53 234.0 54 195.0 55 191.0 56 187.0 57 153.5 58 120.0 59 102.5 60 85.0 61 75.0 62 65.0 63 50.5 64 36.0 65 36.5 66 37.0 67 36.5 68 36.0 69 36.0 70 36.0 71 47.0 72 58.0 73 45.5 74 33.0 75 22.0 76 11.0 77 8.5 78 6.0 79 7.5 80 9.0 81 5.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.05 5 0.0 6 0.1 7 0.17500000000000002 8 0.2 9 0.2 10 0.2 11 0.2 12 0.2 13 0.22499999999999998 14 0.22499999999999998 15 0.2 16 0.2 17 0.2 18 0.22499999999999998 19 0.22499999999999998 20 0.22499999999999998 21 0.22499999999999998 22 0.22499999999999998 23 0.22499999999999998 24 0.22499999999999998 25 0.22499999999999998 26 0.22499999999999998 27 0.22499999999999998 28 0.22499999999999998 29 0.22499999999999998 30 0.22499999999999998 31 0.22499999999999998 32 0.22499999999999998 33 0.22499999999999998 34 0.22499999999999998 35 0.22499999999999998 36 0.22499999999999998 37 0.22499999999999998 38 0.22499999999999998 39 0.22499999999999998 40 0.22499999999999998 41 0.22499999999999998 42 0.22499999999999998 43 0.22499999999999998 44 0.22499999999999998 45 0.22499999999999998 46 0.22499999999999998 47 0.22499999999999998 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.825 #Duplication Level Percentage of deduplicated Percentage of total 1 97.03743603555077 90.075 2 2.2084567734985185 4.1000000000000005 3 0.5386479935362241 1.5 4 0.13466199838405601 0.5 5 0.026932399676811204 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026932399676811204 0.325 >50 0.0 0.0 >100 0.026932399676811204 3.375 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATG 135 3.375 TruSeq Adapter, Index 2 (100% over 49bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 13 0.325 TruSeq Adapter, Index 2 (100% over 50bp) GGATTAACGAGATTCCCACTGTCCCTGTCTACTATCCAGCGAAACCACAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 3.6 0.0 0.0 0.0 0.0 2 3.6 0.0 0.0 0.0 0.0 3 3.6 0.0 0.0 0.0 0.0 4 3.625 0.0 0.0 0.0 0.0 5 3.625 0.0 0.0 0.0 0.0 6 3.625 0.0 0.0 0.0 0.0 7 3.625 0.0 0.0 0.0 0.0 8 3.625 0.0 0.0 0.0 0.0 9 3.625 0.0 0.0 0.0 0.0 10 3.625 0.0 0.0 0.0 0.0 11 3.625 0.0 0.0 0.0 0.0 12 3.625 0.0 0.0 0.0 0.0 13 3.625 0.0 0.0 0.0 0.0 14 3.625 0.0 0.0 0.0 0.0 15 3.625 0.0 0.0 0.0 0.0 16 3.625 0.0 0.0 0.0 0.0 17 3.625 0.0 0.0 0.0 0.0 18 3.625 0.0 0.0 0.0 0.0 19 3.625 0.0 0.0 0.0 0.0 20 3.65 0.0 0.0 0.0 0.0 21 3.65 0.0 0.0 0.0 0.0 22 3.65 0.0 0.0 0.0 0.0 23 3.65 0.0 0.0 0.0 0.0 24 3.65 0.0 0.0 0.0 0.0 25 3.65 0.0 0.0 0.0 0.0 26 3.65 0.0 0.0 0.0 0.0 27 3.65 0.0 0.0 0.0 0.0 28 3.675 0.0 0.0 0.0 0.0 29 3.675 0.0 0.0 0.0 0.0 30 3.675 0.0 0.0 0.0 0.0 31 3.675 0.0 0.0 0.0 0.0 32 3.675 0.0 0.0 0.0 0.0 33 3.675 0.0 0.0 0.0 0.0 34 3.675 0.0 0.0 0.0 0.0 35 3.675 0.0 0.0 0.0 0.0 36 3.675 0.0 0.0 0.0 0.0 37 3.675 0.0 0.0 0.0 0.0 38 3.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACGTC 20 6.9617946E-4 43.9875 14 ATCTCGT 20 6.9617946E-4 43.9875 41 GTCACCG 20 6.9617946E-4 43.9875 30 CAGTCAC 20 6.9617946E-4 43.9875 28 CACACGT 20 6.9617946E-4 43.9875 13 ACGTCTG 20 6.9617946E-4 43.9875 16 CACGTCT 20 6.9617946E-4 43.9875 15 CACCGAT 20 6.9617946E-4 43.9875 32 GTATCTC 20 6.9617946E-4 43.9875 39 AAGAGCA 20 6.9617946E-4 43.9875 8 CTCCAGT 20 6.9617946E-4 43.9875 25 GATCGGA 20 6.9617946E-4 43.9875 2 ACTCCAG 20 6.9617946E-4 43.9875 24 GTCTGAA 20 6.9617946E-4 43.9875 18 GAAGAGC 20 6.9617946E-4 43.9875 7 TCGGAAG 20 6.9617946E-4 43.9875 4 ACCGATG 20 6.9617946E-4 43.9875 33 AACTCCA 20 6.9617946E-4 43.9875 23 GAGCACA 20 6.9617946E-4 43.9875 10 CGGAAGA 20 6.9617946E-4 43.9875 5 >>END_MODULE Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371624 spots for SRR3317181.sra Written 2371624 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra Read 2371623 spots for SRR3317181.sra Written 2371623 spots for SRR3317181.sra SRR ids: ['SRR3317181.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mdu4p1c8 SRR3317181.sra spots: 47432461 blocks: [[1, 2371623], [2371624, 4743246], [4743247, 7114869], [7114870, 9486492], [9486493, 11858115], [11858116, 14229738], [14229739, 16601361], [16601362, 18972984], [18972985, 21344607], [21344608, 23716230], [23716231, 26087853], [26087854, 28459476], [28459477, 30831099], [30831100, 33202722], [33202723, 35574345], [35574346, 37945968], [37945969, 40317591], [40317592, 42689214], [42689215, 45060837], [45060838, 47432461]] SRR3317181 file size 7932667 SRR3317181 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317181 SRR3317181_1.fastq Input file: SRR3317181_1.fastq trimmed: SRR3317181-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:38:22 2025 >> started Tue Feb 11 11:38:42 2025 >> done (20.142s) 47432461 reads processed; of these: 829930 ( 1.75%) short reads filtered out after trimming by size control 2877642 ( 6.07%) empty reads filtered out after trimming by size control 43724889 (92.18%) reads available; of these: 3346566 ( 7.65%) trimmed reads available after processing 40378323 (92.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 46717 0.11% 19 36862 0.08% 20 35678 0.08% 21 35002 0.08% 22 37216 0.09% 23 38430 0.09% 24 40811 0.09% 25 42284 0.10% 26 44448 0.10% 27 45422 0.10% 28 46999 0.11% 29 50271 0.11% 30 53575 0.12% 31 57178 0.13% 32 61780 0.14% 33 59915 0.14% 34 67149 0.15% 35 68515 0.16% 36 72505 0.17% 37 78316 0.18% 38 79332 0.18% 39 88709 0.20% 40 96838 0.22% 41 111856 0.26% 42 127498 0.29% 43 140220 0.32% 44 158586 0.36% 45 189601 0.43% 46 231048 0.53% 47 314084 0.72% 48 341694 0.78% 49 448027 1.02% 50 40378323 92.35% 43724889 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=22 prefix-density=0.25 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=12 fanout-score=65.02 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=8.6 sequence=AAGAAGAAGAAG Started job on | Feb 11 11:38:54 Started mapping on | Feb 11 11:38:54 Finished on | Feb 11 11:39:51 Mapping speed, Million of reads per hour | 2761.57 Number of input reads | 43724889 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 28970175 Uniquely mapped reads % | 66.26% Average mapped length | 49.27 Number of splices: Total | 3586479 Number of splices: Annotated (sjdb) | 3522520 Number of splices: GT/AG | 3526873 Number of splices: GC/AG | 47068 Number of splices: AT/AC | 3047 Number of splices: Non-canonical | 9491 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1929884 % of reads mapped to multiple loci | 4.41% Number of reads mapped to too many loci | 12435032 % of reads mapped to too many loci | 28.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.88% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 12824830 12824830 12824830 N_multimapping 1929884 1929884 1929884 N_noFeature 1418694 15084605 15194267 N_ambiguous 196944 43332 43950 UnstrandedReadsAssigned:27354537 PositiveStrandReadsAssigned:13842238 NegativeStrandReadsAssigned:13731958 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317181 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317181-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,724,889 reads, 37,269,003 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR3317181.ke.tsv 34699 SRR3317181.se.tsv 87100 total ==> SRR3317181.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 984 15.7005 Potri.005G024800.1.v4.1 1035 936 221.015 7.23 Potri.004G059700.1.v4.1 961 862 108 3.83627 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 941.189 10.1331 Potri.016G087400.1.v4.1 270 171 1877.25 336.14 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 33 0.603603 Potri.012G127500.1.v4.1 977 878 52410 1827.73 ==> SRR3317181.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 172 Potri.001G233950.v4.1 12 Potri.001G122700.v4.1 514 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3317181 completed mapping pipeline successfully