Starting /dee2/code/volunteer_pipeline.sh SRR3317189 current disk space = 3053034496000 free memory = 1490455100 SRR3317189 SRAfilesize fd93ec801d664dec4f65f3014887817f SRR3317189.sra SRR3317189.sra file validated SRR3317189 is single end SRR3317189 is conventional basespace SRR3317189 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317189_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.818 34.0 31.0 34.0 27.0 34.0 2 31.075 34.0 31.0 34.0 27.0 34.0 3 31.2605 34.0 31.0 34.0 28.0 34.0 4 34.49925 37.0 35.0 37.0 32.0 37.0 5 34.5125 37.0 35.0 37.0 32.0 37.0 6 34.439 37.0 35.0 37.0 32.0 37.0 7 34.4705 37.0 35.0 37.0 32.0 37.0 8 34.422 37.0 35.0 37.0 32.0 37.0 9 35.97725 39.0 37.0 39.0 32.0 39.0 10 35.802 39.0 37.0 39.0 31.0 39.0 11 35.7325 39.0 37.0 39.0 30.0 39.0 12 35.6265 39.0 37.0 39.0 30.0 39.0 13 35.73925 39.0 37.0 39.0 31.0 39.0 14 37.16975 41.0 38.0 41.0 31.0 41.0 15 37.00375 40.0 38.0 41.0 31.0 41.0 16 37.10375 40.0 38.0 41.0 31.0 41.0 17 37.0715 40.0 38.0 41.0 32.0 41.0 18 36.926 40.0 38.0 41.0 31.0 41.0 19 36.88575 40.0 38.0 41.0 31.0 41.0 20 36.9625 40.0 38.0 41.0 31.0 41.0 21 36.94875 40.0 38.0 41.0 31.0 41.0 22 36.961 40.0 38.0 41.0 31.0 41.0 23 36.835 40.0 38.0 41.0 30.0 41.0 24 36.89425 40.0 38.0 41.0 31.0 41.0 25 36.88425 40.0 38.0 41.0 30.0 41.0 26 36.85025 40.0 38.0 41.0 30.0 41.0 27 36.68375 40.0 38.0 41.0 30.0 41.0 28 36.73425 40.0 38.0 41.0 30.0 41.0 29 36.601 40.0 38.0 41.0 30.0 41.0 30 36.62525 40.0 38.0 41.0 30.0 41.0 31 36.51125 40.0 38.0 41.0 30.0 41.0 32 36.54625 40.0 38.0 41.0 30.0 41.0 33 36.5805 40.0 38.0 41.0 30.0 41.0 34 36.4305 40.0 38.0 41.0 29.0 41.0 35 36.40425 40.0 38.0 41.0 29.0 41.0 36 36.2975 40.0 38.0 41.0 29.0 41.0 37 36.20175 40.0 38.0 41.0 29.0 41.0 38 36.125 40.0 37.0 41.0 29.0 41.0 39 36.01725 40.0 37.0 41.0 27.0 41.0 40 36.04525 40.0 37.0 41.0 28.0 41.0 41 35.985 40.0 37.0 41.0 27.0 41.0 42 35.959 40.0 37.0 41.0 27.0 41.0 43 35.82425 40.0 37.0 41.0 26.0 41.0 44 35.6915 40.0 37.0 41.0 25.0 41.0 45 35.61 40.0 37.0 41.0 25.0 41.0 46 35.38475 40.0 36.0 41.0 24.0 41.0 47 35.32725 40.0 36.0 41.0 24.0 41.0 48 35.07375 40.0 36.0 41.0 23.0 41.0 49 34.9895 40.0 36.0 41.0 21.0 41.0 50 34.07125 39.0 34.0 40.0 2.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 144.0 3 4.0 4 10.0 5 10.0 6 9.0 7 9.0 8 8.0 9 6.0 10 7.0 11 5.0 12 5.0 13 1.0 14 7.0 15 5.0 16 5.0 17 6.0 18 4.0 19 12.0 20 2.0 21 10.0 22 17.0 23 14.0 24 11.0 25 6.0 26 20.0 27 27.0 28 23.0 29 36.0 30 29.0 31 51.0 32 60.0 33 68.0 34 83.0 35 153.0 36 212.0 37 275.0 38 590.0 39 2056.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.46808510638298 13.551165146909828 8.206686930091186 53.77406281661601 2 17.325 21.075 40.550000000000004 21.05 3 18.3 21.975 28.625 31.1 4 22.85 27.6 21.7 27.85 5 27.025 30.349999999999998 22.75 19.875 6 21.925 35.625 22.95 19.5 7 18.275 25.05 37.3 19.375 8 17.479369842460617 27.231807951987996 32.208052013003254 23.080770192548137 9 21.305326331582897 23.1807951987997 33.4333583395849 22.080520130032507 10 19.954988747186796 36.55913978494624 26.331582895723933 17.154288572143038 11 25.45 30.65 22.525000000000002 21.375 12 20.555138784696176 25.18129532383096 27.68192048012003 26.581645411352838 13 20.23511755877939 30.015007503751878 28.38919459729865 21.360680340170084 14 21.135567783891947 28.8144072036018 25.63781890945473 24.412206103051524 15 20.355088772193046 30.257564391097773 26.006501625406354 23.380845211302827 16 22.85571392848212 27.231807951987996 25.30632658164541 24.60615153788447 17 23.705926481620406 28.382095523880967 26.131532883220803 21.780445111277817 18 20.610305152576288 27.863931965982992 28.639319659829916 22.886443221610804 19 21.952440550688358 27.684605757196497 27.133917396745932 23.229036295369212 20 23.404255319148938 28.085106382978726 27.459324155193993 21.051314142678347 21 24.430538172715895 27.058823529411764 27.183979974968707 21.32665832290363 22 21.6270337922403 29.411764705882355 26.558197747183982 22.40300375469337 23 20.200250312891114 29.712140175219027 28.21026282853567 21.877346683354194 24 20.72590738423029 26.958698372966204 26.958698372966204 25.3566958698373 25 20.35043804755945 27.53441802252816 28.81101376720901 23.30413016270338 26 21.407110665999 27.74161241862794 26.489734601902853 24.361542313470206 27 20.450563204005007 27.88485607008761 26.633291614518146 25.03128911138924 28 20.095095095095093 29.254254254254253 26.726726726726728 23.923923923923923 29 23.617713284963724 28.29622216662497 26.99524643482612 21.09081811358519 30 21.5607803901951 27.238619309654826 28.51425712856428 22.686343171585793 31 21.046046046046047 27.32732732732733 26.626626626626624 25.0 32 21.496496496496498 29.904904904904907 26.45145145145145 22.147147147147148 33 21.67709637046308 27.133917396745932 26.382978723404253 24.80600750938673 34 21.00125156445557 28.1351689612015 28.785982478097623 22.07759699624531 35 23.329161451814766 27.95994993742178 26.68335419274093 22.02753441802253 36 21.451814768460576 29.21151439299124 26.433041301627036 22.90362953692115 37 20.94070552914686 27.445584188141105 27.220415311483613 24.39329497122842 38 21.32665832290363 27.734668335419272 27.284105131414265 23.654568210262827 39 21.201501877346686 29.812265331664577 27.284105131414265 21.70212765957447 40 21.752190237797247 30.43804755944931 26.633291614518146 21.176470588235293 41 22.597597597597595 27.27727727727728 28.303303303303302 21.82182182182182 42 21.935967983991997 27.363681840920464 26.93846923461731 23.761880940470235 43 21.576971214017522 27.133917396745932 28.335419274092615 22.95369211514393 44 22.17217217217217 27.2022022022022 26.75175175175175 23.873873873873876 45 21.60200250312891 29.586983729662077 26.958698372966204 21.8523153942428 46 21.27659574468085 26.48310387984981 29.962453066332916 22.27784730913642 47 22.8592889334001 29.16875312969454 27.290936404606907 20.681021532298445 48 21.45 27.025 28.775000000000002 22.75 49 22.375 27.950000000000003 27.224999999999998 22.45 50 22.575 27.675 26.224999999999998 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 3.5 20 6.0 21 7.0 22 8.0 23 9.5 24 11.0 25 13.5 26 16.0 27 29.5 28 43.0 29 55.5 30 68.0 31 98.0 32 128.0 33 135.0 34 142.0 35 175.5 36 209.0 37 234.5 38 260.0 39 298.5 40 337.0 41 361.0 42 385.0 43 384.5 44 384.0 45 397.5 46 411.0 47 396.5 48 382.0 49 349.0 50 316.0 51 325.0 52 334.0 53 255.5 54 177.0 55 152.5 56 128.0 57 106.5 58 85.0 59 71.0 60 57.0 61 44.0 62 31.0 63 24.0 64 17.0 65 15.5 66 14.0 67 12.5 68 11.0 69 12.5 70 14.0 71 11.0 72 8.0 73 7.0 74 6.0 75 5.0 76 4.0 77 2.5 78 1.0 79 0.5 80 0.0 81 0.5 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.025 10 0.025 11 0.0 12 0.025 13 0.05 14 0.05 15 0.025 16 0.025 17 0.025 18 0.05 19 0.125 20 0.125 21 0.125 22 0.125 23 0.125 24 0.125 25 0.125 26 0.15 27 0.125 28 0.1 29 0.075 30 0.05 31 0.1 32 0.1 33 0.125 34 0.125 35 0.125 36 0.125 37 0.075 38 0.125 39 0.125 40 0.125 41 0.1 42 0.05 43 0.125 44 0.1 45 0.125 46 0.125 47 0.15 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.61676034747062 97.475 2 0.3321410321921308 0.65 3 0.02554931016862545 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02554931016862545 1.7999999999999998 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 72 1.7999999999999998 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.2 0.0 0.0 0.0 0.0 22 0.2 0.0 0.0 0.0 0.0 23 0.2 0.0 0.0 0.0 0.0 24 0.2 0.0 0.0 0.0 0.0 25 0.2 0.0 0.0 0.0 0.0 26 0.2 0.0 0.0 0.0 0.0 27 0.225 0.0 0.0 0.0 0.0 28 0.225 0.0 0.0 0.0 0.0 29 0.225 0.0 0.0 0.0 0.0 30 0.225 0.0 0.0 0.0 0.0 31 0.225 0.0 0.0 0.0 0.0 32 0.225 0.0 0.0 0.0 0.0 33 0.225 0.0 0.0 0.0 0.0 34 0.225 0.0 0.0 0.0 0.0 35 0.225 0.0 0.0 0.0 0.0 36 0.225 0.0 0.0 0.0 0.0 37 0.225 0.0 0.0 0.0 0.0 38 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745948 spots for SRR3317189.sra Written 1745948 spots for SRR3317189.sra Read 1745965 spots for SRR3317189.sra Written 1745965 spots for SRR3317189.sra SRR ids: ['SRR3317189.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tl24fvij SRR3317189.sra spots: 34918977 blocks: [[1, 1745948], [1745949, 3491896], [3491897, 5237844], [5237845, 6983792], [6983793, 8729740], [8729741, 10475688], [10475689, 12221636], [12221637, 13967584], [13967585, 15713532], [15713533, 17459480], [17459481, 19205428], [19205429, 20951376], [20951377, 22697324], [22697325, 24443272], [24443273, 26189220], [26189221, 27935168], [27935169, 29681116], [29681117, 31427064], [31427065, 33173012], [33173013, 34918977]] SRR3317189 file size 5837036 SRR3317189 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317189 SRR3317189_1.fastq Input file: SRR3317189_1.fastq trimmed: SRR3317189-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:36:27 2025 >> started Tue Feb 11 10:36:43 2025 >> done (15.713s) 34918977 reads processed; of these: 566107 ( 1.62%) short reads filtered out after trimming by size control 1997603 ( 5.72%) empty reads filtered out after trimming by size control 32355267 (92.66%) reads available; of these: 1971208 ( 6.09%) trimmed reads available after processing 30384059 (93.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 30562 0.09% 19 24679 0.08% 20 22935 0.07% 21 23217 0.07% 22 22173 0.07% 23 25326 0.08% 24 23696 0.07% 25 23952 0.07% 26 24663 0.08% 27 25336 0.08% 28 25928 0.08% 29 27166 0.08% 30 27983 0.09% 31 30909 0.10% 32 31897 0.10% 33 32689 0.10% 34 35146 0.11% 35 37011 0.11% 36 39783 0.12% 37 42844 0.13% 38 45654 0.14% 39 49926 0.15% 40 54727 0.17% 41 61692 0.19% 42 70665 0.22% 43 80158 0.25% 44 93039 0.29% 45 111493 0.34% 46 137674 0.43% 47 192199 0.59% 48 213414 0.66% 49 282672 0.87% 50 30384059 93.91% 32355267 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=34.10 fanout-score-rank=4 prefix-density=0.18 prefix-fanout=11.0 sequence=CTTCTTCTTCCTTTGGGGCTTCGACTGCAACCTCCGTTTCTTCTGCCGGTGCCTCACCAGGCTCTGTAGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=12 fanout-score=61.09 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=9.0 sequence=AAGAAGAAGAAG Started job on | Feb 11 10:36:58 Started mapping on | Feb 11 10:36:58 Finished on | Feb 11 10:37:33 Mapping speed, Million of reads per hour | 3327.97 Number of input reads | 32355267 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 28582728 Uniquely mapped reads % | 88.34% Average mapped length | 49.31 Number of splices: Total | 3654994 Number of splices: Annotated (sjdb) | 3593365 Number of splices: GT/AG | 3601591 Number of splices: GC/AG | 41606 Number of splices: AT/AC | 3190 Number of splices: Non-canonical | 8607 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.02% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1673999 % of reads mapped to multiple loci | 5.17% Number of reads mapped to too many loci | 1659292 % of reads mapped to too many loci | 5.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2098540 2098540 2098540 N_multimapping 1673999 1673999 1673999 N_noFeature 1484429 14937753 15007935 N_ambiguous 200803 38969 40634 UnstrandedReadsAssigned:26897496 PositiveStrandReadsAssigned:13606006 NegativeStrandReadsAssigned:13534159 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317189 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317189-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,355,267 reads, 27,703,681 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR3317189.ke.tsv 34699 SRR3317189.se.tsv 87100 total ==> SRR3317189.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2064.59 51.1664 Potri.005G024800.1.v4.1 1035 936 643.034 32.6726 Potri.004G059700.1.v4.1 961 862 104 5.73789 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 955.49 15.978 Potri.016G087400.1.v4.1 270 171 1955.64 543.899 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 27.6648 0.785954 Potri.012G127500.1.v4.1 977 878 10090 546.541 ==> SRR3317189.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1020 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 317 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR3317189 completed mapping pipeline successfully