Starting /dee2/code/volunteer_pipeline.sh SRR3317201 current disk space = 3052476506112 free memory = 1478414460 SRR3317201 SRAfilesize 6b86cb7bb49e27b77e241b0c8a944122 SRR3317201.sra SRR3317201.sra file validated SRR3317201 is single end SRR3317201 is conventional basespace SRR3317201 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317201_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3425 34.0 31.0 34.0 28.0 34.0 2 31.659 34.0 31.0 34.0 28.0 34.0 3 31.85475 34.0 31.0 34.0 28.0 34.0 4 35.18825 37.0 35.0 37.0 33.0 37.0 5 35.15975 37.0 35.0 37.0 33.0 37.0 6 35.1735 37.0 35.0 37.0 33.0 37.0 7 35.1995 37.0 35.0 37.0 33.0 37.0 8 35.11675 37.0 35.0 37.0 33.0 37.0 9 36.82375 39.0 38.0 39.0 33.0 39.0 10 36.56575 39.0 37.0 39.0 33.0 39.0 11 36.58875 39.0 37.0 39.0 33.0 39.0 12 36.36625 39.0 37.0 39.0 32.0 39.0 13 36.49775 39.0 37.0 39.0 33.0 39.0 14 37.9685 41.0 38.0 41.0 33.0 41.0 15 37.81175 40.0 38.0 41.0 33.0 41.0 16 37.957 41.0 38.0 41.0 33.0 41.0 17 37.87275 41.0 38.0 41.0 33.0 41.0 18 37.75075 41.0 38.0 41.0 32.0 41.0 19 37.79225 40.0 38.0 41.0 32.0 41.0 20 37.75875 40.0 38.0 41.0 32.0 41.0 21 37.83325 40.0 38.0 41.0 33.0 41.0 22 37.75875 41.0 38.0 41.0 33.0 41.0 23 37.6875 40.0 38.0 41.0 32.0 41.0 24 37.69 40.0 38.0 41.0 32.0 41.0 25 37.626 40.0 38.0 41.0 32.0 41.0 26 37.61825 40.0 38.0 41.0 32.0 41.0 27 37.37675 40.0 38.0 41.0 32.0 41.0 28 37.45875 40.0 38.0 41.0 32.0 41.0 29 37.34675 40.0 38.0 41.0 32.0 41.0 30 37.34525 40.0 38.0 41.0 32.0 41.0 31 37.239 40.0 38.0 41.0 31.0 41.0 32 37.22475 40.0 38.0 41.0 31.0 41.0 33 37.07325 40.0 38.0 41.0 31.0 41.0 34 37.03725 40.0 38.0 41.0 31.0 41.0 35 37.02975 40.0 38.0 41.0 31.0 41.0 36 36.9355 40.0 38.0 41.0 30.0 41.0 37 36.85 40.0 37.0 41.0 30.0 41.0 38 36.72925 40.0 38.0 41.0 30.0 41.0 39 36.731 40.0 37.0 41.0 30.0 41.0 40 36.6375 40.0 37.0 41.0 30.0 41.0 41 36.471 40.0 37.0 41.0 30.0 41.0 42 36.48225 40.0 37.0 41.0 30.0 41.0 43 36.30575 40.0 37.0 41.0 29.0 41.0 44 36.2035 40.0 37.0 41.0 29.0 41.0 45 36.13425 40.0 37.0 41.0 29.0 41.0 46 35.858 40.0 36.0 41.0 28.0 41.0 47 35.63225 40.0 36.0 41.0 27.0 41.0 48 35.432 40.0 36.0 41.0 25.0 41.0 49 35.3425 40.0 36.0 41.0 25.0 41.0 50 34.3565 39.0 34.0 40.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 69.0 3 3.0 4 9.0 5 8.0 6 5.0 7 5.0 8 5.0 9 5.0 10 6.0 11 7.0 12 5.0 13 7.0 14 3.0 15 5.0 16 6.0 17 6.0 18 8.0 19 6.0 20 8.0 21 11.0 22 10.0 23 8.0 24 18.0 25 15.0 26 23.0 27 27.0 28 37.0 29 28.0 30 42.0 31 43.0 32 71.0 33 83.0 34 105.0 35 133.0 36 218.0 37 309.0 38 575.0 39 2068.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.71501272264631 14.681933842239186 8.727735368956743 52.87531806615776 2 19.45 19.05 38.3 23.200000000000003 3 20.325 20.5 26.224999999999998 32.95 4 24.60615153788447 27.35683920980245 20.7551887971993 27.28182045511378 5 26.1 31.6 21.3 21.0 6 20.980245061265315 34.808702175543885 24.20605151287822 20.005001250312578 7 19.154788697174293 22.85571392848212 37.934483620905226 20.05501375343836 8 19.09887359198999 25.406758448060074 32.21526908635794 23.27909887359199 9 19.779669504256383 22.25838758137206 34.05107661492238 23.910866299449175 10 20.58087130696044 35.10265398097146 25.913870806209317 18.40260390585879 11 24.455569461827285 28.185231539424283 21.8523153942428 25.50688360450563 12 21.4321482223335 25.31296945418127 27.090635953930896 26.164246369554334 13 20.681021532298445 28.668002003004506 29.44416624937406 21.206810215322985 14 21.437515652391685 27.62334084648134 27.973954420235415 22.96518908089156 15 22.22778473091364 28.410513141426787 26.23279098873592 23.128911138923655 16 21.526908635794744 27.88485607008761 27.2090112640801 23.379224030037545 17 22.208312468703053 28.24236354531798 27.265898848272407 22.283425137706562 18 22.514400200350615 27.247683446030553 25.820185324317556 24.417731029301276 19 22.46176986713462 27.224868388067186 27.099523690147908 23.21383805465029 20 22.882205513784463 28.345864661654137 26.64160401002506 22.13032581453634 21 23.609022556390975 27.44360902255639 26.917293233082706 22.030075187969924 22 22.355889724310778 28.045112781954888 26.766917293233085 22.832080200501252 23 22.807017543859647 28.847117794486216 26.54135338345865 21.804511278195488 24 22.11080471296064 29.88217598395588 25.09400852343946 22.913010779644022 25 21.43394334419654 27.325144146402607 27.275006267234897 23.965906242165957 26 22.54828191622774 28.016052169551042 26.435916729370458 22.999749184850764 27 22.436700927550763 27.42541990473803 27.450488844321885 22.68739032338932 28 22.080200501253135 27.94486215538847 26.842105263157894 23.1328320802005 29 23.703332498120773 27.31145076421949 26.259082936607363 22.726133801052367 30 21.63786626596544 28.249436513899322 27.42299023290759 22.68970698722765 31 21.779448621553886 27.39348370927318 27.56892230576441 23.258145363408524 32 23.533834586466167 26.240601503759397 27.21804511278195 23.007518796992482 33 22.932330827067666 27.468671679197993 26.14035087719298 23.458646616541355 34 21.684632740035095 27.676109300576584 25.41990473802958 25.219353221358737 35 22.63157894736842 27.769423558897245 25.13784461152882 24.461152882205514 36 20.080220606668338 28.202557031837554 28.35297066934069 23.364251692153424 37 24.085213032581454 27.21804511278195 25.36340852130326 23.333333333333332 38 22.93807971922788 27.87666081724743 25.871145650538985 23.31411381298571 39 21.578947368421055 28.145363408521302 27.24310776942356 23.032581453634084 40 22.355889724310778 27.518796992481203 27.04260651629073 23.082706766917294 41 21.879699248120303 29.022556390977446 26.64160401002506 22.45614035087719 42 22.71475081392437 26.897069872276486 27.0473328324568 23.340846481342346 43 23.7152168463274 27.751316119328152 26.12183504637754 22.41163198796691 44 22.681704260651628 28.045112781954888 26.466165413533833 22.807017543859647 45 22.25563909774436 28.79699248120301 26.967418546365913 21.979949874686717 46 24.736842105263158 26.64160401002506 26.766917293233085 21.854636591478695 47 21.133116069190272 27.550764602657306 27.951867635998994 23.364251692153424 48 22.0 28.999999999999996 27.150000000000002 21.85 49 23.1 27.725 26.525 22.650000000000002 50 22.325 27.800000000000004 26.825 23.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 2.0 7 1.0 8 0.0 9 1.0 10 2.0 11 2.5 12 3.0 13 2.5 14 2.0 15 1.5 16 1.0 17 2.5 18 4.0 19 5.5 20 7.0 21 6.0 22 5.0 23 12.0 24 19.0 25 23.5 26 28.0 27 35.0 28 42.0 29 52.5 30 63.0 31 86.5 32 110.0 33 123.0 34 136.0 35 163.0 36 190.0 37 219.5 38 249.0 39 290.5 40 332.0 41 342.0 42 352.0 43 366.0 44 380.0 45 379.5 46 379.0 47 370.0 48 361.0 49 338.0 50 315.0 51 280.0 52 245.0 53 221.5 54 198.0 55 182.5 56 167.0 57 135.5 58 104.0 59 85.0 60 66.0 61 64.5 62 63.0 63 44.5 64 26.0 65 31.5 66 37.0 67 26.5 68 16.0 69 22.5 70 29.0 71 31.0 72 33.0 73 23.5 74 14.0 75 11.5 76 9.0 77 6.0 78 3.0 79 3.0 80 3.0 81 3.0 82 3.0 83 2.0 84 1.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.025 5 0.0 6 0.025 7 0.025 8 0.125 9 0.15 10 0.15 11 0.125 12 0.15 13 0.15 14 0.17500000000000002 15 0.125 16 0.125 17 0.15 18 0.17500000000000002 19 0.27499999999999997 20 0.25 21 0.25 22 0.25 23 0.25 24 0.27499999999999997 25 0.27499999999999997 26 0.325 27 0.27499999999999997 28 0.25 29 0.22499999999999998 30 0.17500000000000002 31 0.25 32 0.25 33 0.25 34 0.27499999999999997 35 0.25 36 0.27499999999999997 37 0.25 38 0.27499999999999997 39 0.25 40 0.25 41 0.25 42 0.17500000000000002 43 0.27499999999999997 44 0.25 45 0.25 46 0.25 47 0.27499999999999997 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72870582252733 97.075 2 0.9916094584286803 1.95 3 0.2288329519450801 0.675 4 0.02542588354945334 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02542588354945334 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 8 0.2 TruSeq Adapter, Index 5 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933233 spots for SRR3317201.sra Written 1933233 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra Read 1933227 spots for SRR3317201.sra Written 1933227 spots for SRR3317201.sra SRR ids: ['SRR3317201.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gb30wbjb SRR3317201.sra spots: 38664546 blocks: [[1, 1933227], [1933228, 3866454], [3866455, 5799681], [5799682, 7732908], [7732909, 9666135], [9666136, 11599362], [11599363, 13532589], [13532590, 15465816], [15465817, 17399043], [17399044, 19332270], [19332271, 21265497], [21265498, 23198724], [23198725, 25131951], [25131952, 27065178], [27065179, 28998405], [28998406, 30931632], [30931633, 32864859], [32864860, 34798086], [34798087, 36731313], [36731314, 38664546]] SRR3317201 file size 6464302 SRR3317201 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317201 SRR3317201_1.fastq Input file: SRR3317201_1.fastq trimmed: SRR3317201-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:02:36 2025 >> started Tue Feb 11 11:02:54 2025 >> done (18.670s) 38664546 reads processed; of these: 656672 ( 1.70%) short reads filtered out after trimming by size control 870084 ( 2.25%) empty reads filtered out after trimming by size control 37137790 (96.05%) reads available; of these: 2497372 ( 6.72%) trimmed reads available after processing 34640418 (93.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 35376 0.10% 19 27848 0.07% 20 26269 0.07% 21 26244 0.07% 22 27280 0.07% 23 28342 0.08% 24 29484 0.08% 25 30551 0.08% 26 31780 0.09% 27 31982 0.09% 28 33792 0.09% 29 35559 0.10% 30 38487 0.10% 31 40454 0.11% 32 43504 0.12% 33 42999 0.12% 34 47348 0.13% 35 48652 0.13% 36 52376 0.14% 37 56463 0.15% 38 58899 0.16% 39 64753 0.17% 40 70516 0.19% 41 81389 0.22% 42 93336 0.25% 43 104114 0.28% 44 119292 0.32% 45 142617 0.38% 46 175091 0.47% 47 240324 0.65% 48 265367 0.71% 49 346884 0.93% 50 34640418 93.28% 37137790 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=25 prefix-density=0.16 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=87.59 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.8 sequence=AAGAAGAAGAAG Started job on | Feb 11 11:03:07 Started mapping on | Feb 11 11:03:07 Finished on | Feb 11 11:03:52 Mapping speed, Million of reads per hour | 2971.02 Number of input reads | 37137790 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 28378695 Uniquely mapped reads % | 76.41% Average mapped length | 49.32 Number of splices: Total | 3804165 Number of splices: Annotated (sjdb) | 3739405 Number of splices: GT/AG | 3740284 Number of splices: GC/AG | 51983 Number of splices: AT/AC | 3291 Number of splices: Non-canonical | 8607 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.02% Deletion average length | 1.67 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1732741 % of reads mapped to multiple loci | 4.67% Number of reads mapped to too many loci | 6527847 % of reads mapped to too many loci | 17.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.33% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7026354 7026354 7026354 N_multimapping 1732741 1732741 1732741 N_noFeature 1437030 14768292 14922523 N_ambiguous 206401 40349 41623 UnstrandedReadsAssigned:26735264 PositiveStrandReadsAssigned:13570054 NegativeStrandReadsAssigned:13414549 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317201 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317201-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,137,790 reads, 31,709,554 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR3317201.ke.tsv 34699 SRR3317201.se.tsv 87100 total ==> SRR3317201.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1078.55 21.2951 Potri.005G024800.1.v4.1 1035 936 193.007 7.81284 Potri.004G059700.1.v4.1 961 862 118 5.18665 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1207.69 16.0893 Potri.016G087400.1.v4.1 270 171 1327.65 294.172 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15 0.339507 Potri.012G127500.1.v4.1 977 878 64839 2798.04 ==> SRR3317201.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 331 Potri.001G233950.v4.1 9 Potri.001G122700.v4.1 712 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 16 SRR3317201 completed mapping pipeline successfully