Starting /dee2/code/volunteer_pipeline.sh SRR3317206 current disk space = 3052866363392 free memory = 1418891696 SRR3317206 SRAfilesize 78fc2abfc40aee371422646440218263 SRR3317206.sra SRR3317206.sra file validated SRR3317206 is single end SRR3317206 is conventional basespace SRR3317206 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317206_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.43225 34.0 31.0 34.0 28.0 34.0 2 31.731 34.0 31.0 34.0 28.0 34.0 3 31.91575 34.0 31.0 34.0 28.0 34.0 4 35.14225 37.0 35.0 37.0 32.0 37.0 5 35.16525 37.0 35.0 37.0 33.0 37.0 6 35.04625 37.0 35.0 37.0 32.0 37.0 7 35.08125 37.0 35.0 37.0 33.0 37.0 8 35.04075 37.0 35.0 37.0 33.0 37.0 9 36.651 39.0 38.0 39.0 33.0 39.0 10 36.5585 39.0 37.0 39.0 33.0 39.0 11 36.49 39.0 37.0 39.0 32.0 39.0 12 36.32175 39.0 37.0 39.0 32.0 39.0 13 36.526 39.0 37.0 39.0 33.0 39.0 14 37.9885 41.0 38.0 41.0 33.0 41.0 15 37.7835 40.0 38.0 41.0 33.0 41.0 16 37.91925 41.0 38.0 41.0 33.0 41.0 17 37.822 40.0 38.0 41.0 33.0 41.0 18 37.75325 40.0 38.0 41.0 33.0 41.0 19 37.72175 40.0 38.0 41.0 33.0 41.0 20 37.71625 40.0 38.0 41.0 33.0 41.0 21 37.72325 40.0 38.0 41.0 33.0 41.0 22 37.83775 40.0 39.0 41.0 33.0 41.0 23 37.69375 40.0 38.0 41.0 33.0 41.0 24 37.6235 40.0 38.0 41.0 32.0 41.0 25 37.66225 40.0 38.0 41.0 32.0 41.0 26 37.6825 40.0 38.0 41.0 33.0 41.0 27 37.363 40.0 38.0 41.0 31.0 41.0 28 37.53 40.0 38.0 41.0 32.0 41.0 29 37.336 40.0 38.0 41.0 32.0 41.0 30 37.332 40.0 38.0 41.0 32.0 41.0 31 37.259 40.0 38.0 41.0 31.0 41.0 32 37.23875 40.0 38.0 41.0 31.0 41.0 33 37.3195 40.0 38.0 41.0 32.0 41.0 34 37.16275 40.0 38.0 41.0 31.0 41.0 35 37.20575 40.0 38.0 41.0 31.0 41.0 36 37.01675 40.0 38.0 41.0 31.0 41.0 37 36.946 40.0 38.0 41.0 31.0 41.0 38 36.87775 40.0 38.0 41.0 30.0 41.0 39 36.76275 40.0 38.0 41.0 30.0 41.0 40 36.7975 40.0 38.0 41.0 30.0 41.0 41 36.707 40.0 38.0 41.0 30.0 41.0 42 36.69925 40.0 38.0 41.0 30.0 41.0 43 36.5235 40.0 37.0 41.0 30.0 41.0 44 36.389 40.0 37.0 41.0 30.0 41.0 45 36.3785 40.0 37.0 41.0 29.0 41.0 46 36.14825 40.0 37.0 41.0 29.0 41.0 47 36.0105 40.0 37.0 41.0 28.0 41.0 48 35.73725 40.0 36.0 41.0 27.0 41.0 49 35.81125 40.0 36.0 41.0 28.0 41.0 50 34.81075 39.0 35.0 40.0 24.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 70.0 3 2.0 4 17.0 5 8.0 6 2.0 7 6.0 8 5.0 9 6.0 10 4.0 11 6.0 12 3.0 13 2.0 14 4.0 15 1.0 16 9.0 17 10.0 18 1.0 19 6.0 20 7.0 21 10.0 22 8.0 23 14.0 24 15.0 25 18.0 26 24.0 27 26.0 28 30.0 29 26.0 30 44.0 31 41.0 32 67.0 33 84.0 34 101.0 35 132.0 36 184.0 37 299.0 38 633.0 39 2075.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.373576309794988 17.0083523158694 8.85851683118198 49.759554543153634 2 20.674999999999997 18.825 38.475 22.025 3 19.975 22.2 26.450000000000003 31.374999999999996 4 23.65 28.075 21.525 26.75 5 26.5 32.375 22.900000000000002 18.224999999999998 6 20.78019504876219 37.184296074018505 22.48062015503876 19.554888722180543 7 18.179544886221557 23.755938984746187 39.20980245061265 18.854713678419603 8 18.613960470352765 23.892919689767325 33.500125093820365 23.992994746059544 9 20.200250312891114 23.654568210262827 33.81727158948686 22.327909887359198 10 19.249061326658325 36.79599499374218 26.958698372966204 16.99624530663329 11 24.44333249937453 29.74731048286215 23.14235676757568 22.66700025018764 12 21.827284105131415 26.5081351689612 28.010012515644554 23.654568210262827 13 20.52565707133917 29.21151439299124 28.961201501877348 21.30162703379224 14 20.600750938673343 27.98498122653317 28.53566958698373 22.878598247809762 15 20.665499124343256 28.42131598699024 26.870152614460846 24.043032274205654 16 21.61621215911934 27.670753064798596 28.371278458844134 22.34175631723793 17 23.329161451814766 26.883604505632043 27.859824780976222 21.927409261576972 18 22.703379224030037 27.008760951188986 27.083854818523157 23.204005006257823 19 21.860115317122087 29.330659313111056 27.124592629731765 21.684632740035095 20 22.45614035087719 27.167919799498748 27.769423558897245 22.606516290726816 21 21.37844611528822 28.095238095238095 27.56892230576441 22.957393483709275 22 21.67919799498747 29.223057644110273 26.64160401002506 22.45614035087719 23 21.353383458646615 29.32330827067669 26.766917293233085 22.55639097744361 24 22.085735773376786 28.32790172975683 27.826522938079716 21.759839558786666 25 22.336425169215342 27.42541990473803 28.4031085485084 21.83504637753823 26 21.951831409934773 29.578524836929255 26.743602609131962 21.726041144004014 27 22.16094259212835 27.400350965154175 27.14966156931562 23.289044873401853 28 21.152882205513784 28.62155388471178 28.045112781954888 22.18045112781955 29 21.16733466933868 28.181362725450903 28.557114228456914 22.094188376753507 30 22.658988482724084 26.339509263895845 27.94191286930396 23.059589384076116 31 22.069138276553108 27.605210420841686 27.304609218436877 23.021042084168336 32 22.105263157894736 28.446115288220554 27.44360902255639 22.005012531328322 33 21.303258145363408 27.919799498746865 28.07017543859649 22.706766917293233 34 22.612183504637752 27.500626723489596 27.174730508899476 22.712459262973177 35 21.654135338345863 28.496240601503757 27.89473684210526 21.954887218045112 36 22.63725244422161 28.202557031837554 25.795938831787414 23.364251692153424 37 22.57014028056112 27.70541082164329 27.054108216432866 22.670340681362724 38 22.73752820255703 29.65655552770118 26.422662321383804 21.183253948357986 39 20.952380952380953 29.423558897243108 27.593984962406015 22.030075187969924 40 21.604010025062657 28.521303258145362 27.493734335839598 22.380952380952383 41 22.019038076152306 28.95791583166333 27.404809619238478 21.618236472945892 42 21.827284105131415 27.659574468085108 27.284105131414265 23.229036295369212 43 21.389167502507522 28.88665997993982 27.08124373119358 22.642928786359075 44 22.851415685291908 27.3365071410674 27.48684540215485 22.325231771485843 45 21.629072681704262 27.44360902255639 28.24561403508772 22.681704260651628 46 22.63157894736842 27.343358395989974 27.44360902255639 22.581453634085214 47 22.999749184850764 27.514421871081012 28.16654125909205 21.319287684976175 48 22.375 27.85 26.724999999999998 23.05 49 22.1 29.099999999999998 26.375 22.425 50 22.925 28.075 27.325 21.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 2.0 7 1.0 8 0.0 9 1.5 10 3.0 11 1.5 12 0.0 13 0.0 14 0.0 15 2.0 16 4.0 17 6.0 18 8.0 19 5.0 20 2.0 21 5.0 22 8.0 23 10.0 24 12.0 25 20.0 26 28.0 27 35.0 28 42.0 29 56.0 30 70.0 31 83.5 32 97.0 33 126.5 34 156.0 35 181.0 36 206.0 37 257.5 38 309.0 39 335.5 40 362.0 41 360.5 42 359.0 43 374.5 44 390.0 45 421.5 46 453.0 47 403.5 48 354.0 49 329.0 50 304.0 51 279.0 52 254.0 53 219.0 54 184.0 55 165.5 56 147.0 57 112.0 58 77.0 59 63.0 60 49.0 61 38.0 62 27.0 63 24.0 64 21.0 65 19.5 66 18.0 67 19.0 68 20.0 69 14.5 70 9.0 71 11.0 72 13.0 73 10.0 74 7.0 75 5.0 76 3.0 77 1.5 78 0.0 79 0.5 80 1.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.075 9 0.125 10 0.125 11 0.075 12 0.125 13 0.125 14 0.125 15 0.075 16 0.075 17 0.125 18 0.125 19 0.27499999999999997 20 0.25 21 0.25 22 0.25 23 0.25 24 0.27499999999999997 25 0.27499999999999997 26 0.35000000000000003 27 0.27499999999999997 28 0.25 29 0.2 30 0.15 31 0.2 32 0.25 33 0.25 34 0.27499999999999997 35 0.25 36 0.27499999999999997 37 0.2 38 0.27499999999999997 39 0.25 40 0.25 41 0.2 42 0.125 43 0.3 44 0.22499999999999998 45 0.25 46 0.25 47 0.325 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.3769791404875597 0.75 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.025131942699170642 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 5 0.125 TruSeq Adapter, Index 6 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799024 spots for SRR3317206.sra Written 1799024 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra Read 1799014 spots for SRR3317206.sra Written 1799014 spots for SRR3317206.sra SRR ids: ['SRR3317206.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pbiaytp6 SRR3317206.sra spots: 35980290 blocks: [[1, 1799014], [1799015, 3598028], [3598029, 5397042], [5397043, 7196056], [7196057, 8995070], [8995071, 10794084], [10794085, 12593098], [12593099, 14392112], [14392113, 16191126], [16191127, 17990140], [17990141, 19789154], [19789155, 21588168], [21588169, 23387182], [23387183, 25186196], [25186197, 26985210], [26985211, 28784224], [28784225, 30583238], [30583239, 32382252], [32382253, 34181266], [34181267, 35980290]] SRR3317206 file size 6014762 SRR3317206 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317206 SRR3317206_1.fastq Input file: SRR3317206_1.fastq trimmed: SRR3317206-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:50:32 2025 >> started Tue Feb 11 10:50:47 2025 >> done (15.089s) 35980290 reads processed; of these: 577350 ( 1.60%) short reads filtered out after trimming by size control 875899 ( 2.43%) empty reads filtered out after trimming by size control 34527041 (95.96%) reads available; of these: 2122881 ( 6.15%) trimmed reads available after processing 32404160 (93.85%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 29905 0.09% 19 23746 0.07% 20 22227 0.06% 21 22231 0.06% 22 22757 0.07% 23 23315 0.07% 24 23458 0.07% 25 24063 0.07% 26 25231 0.07% 27 26221 0.08% 28 27026 0.08% 29 28175 0.08% 30 29616 0.09% 31 32107 0.09% 32 34059 0.10% 33 34578 0.10% 34 37255 0.11% 35 39278 0.11% 36 42329 0.12% 37 46011 0.13% 38 49411 0.14% 39 53240 0.15% 40 59046 0.17% 41 67567 0.20% 42 78079 0.23% 43 87256 0.25% 44 100912 0.29% 45 120891 0.35% 46 151473 0.44% 47 212051 0.61% 48 236271 0.68% 49 313096 0.91% 50 32404160 93.85% 34527041 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=28.11 fanout-score-rank=2 prefix-density=0.15 prefix-fanout=9.8 sequence=CTTCTTCTTCCTTTGGGGCTTCGACTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=11 fanout-score=59.38 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=12.9 sequence=CCACCACCAGCA Started job on | Feb 11 10:51:03 Started mapping on | Feb 11 10:51:04 Finished on | Feb 11 10:51:38 Mapping speed, Million of reads per hour | 3655.80 Number of input reads | 34527041 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 30426895 Uniquely mapped reads % | 88.12% Average mapped length | 49.33 Number of splices: Total | 3788805 Number of splices: Annotated (sjdb) | 3728290 Number of splices: GT/AG | 3734938 Number of splices: GC/AG | 42783 Number of splices: AT/AC | 2938 Number of splices: Non-canonical | 8146 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.02% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1573843 % of reads mapped to multiple loci | 4.56% Number of reads mapped to too many loci | 2236863 % of reads mapped to too many loci | 6.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.82% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2526303 2526303 2526303 N_multimapping 1573843 1573843 1573843 N_noFeature 1444624 15723515 15975832 N_ambiguous 256005 40944 43197 UnstrandedReadsAssigned:28726266 PositiveStrandReadsAssigned:14662436 NegativeStrandReadsAssigned:14407866 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317206 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317206-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,527,041 reads, 29,963,249 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR3317206.ke.tsv 34699 SRR3317206.se.tsv 87100 total ==> SRR3317206.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1080 24.9445 Potri.005G024800.1.v4.1 1035 936 173.01 8.19258 Potri.004G059700.1.v4.1 961 862 32 1.64539 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 885.323 13.7974 Potri.016G087400.1.v4.1 270 171 1886.78 489.048 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 44.6607 1.18249 Potri.012G127500.1.v4.1 977 878 3480 175.676 ==> SRR3317206.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3560 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 483 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3317206 completed mapping pipeline successfully