Starting /dee2/code/volunteer_pipeline.sh SRR3317207 current disk space = 3051181441024 free memory = 1572615252 SRR3317207 SRAfilesize 67fba53cdab6712057b5a94b0bcf6b85 SRR3317207.sra SRR3317207.sra file validated SRR3317207 is single end SRR3317207 is conventional basespace SRR3317207 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317207_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1775 34.0 31.0 34.0 28.0 34.0 2 31.50075 34.0 31.0 34.0 28.0 34.0 3 31.5875 34.0 31.0 34.0 28.0 34.0 4 34.88525 37.0 35.0 37.0 32.0 37.0 5 34.8595 37.0 35.0 37.0 32.0 37.0 6 34.7225 37.0 35.0 37.0 32.0 37.0 7 34.767 37.0 35.0 37.0 32.0 37.0 8 34.72925 37.0 35.0 37.0 32.0 37.0 9 36.28025 39.0 37.0 39.0 32.0 39.0 10 36.046 39.0 37.0 39.0 32.0 39.0 11 36.06025 39.0 37.0 39.0 32.0 39.0 12 35.906 39.0 37.0 39.0 31.0 39.0 13 36.0675 39.0 37.0 39.0 32.0 39.0 14 37.51225 41.0 38.0 41.0 32.0 41.0 15 37.3865 40.0 38.0 41.0 32.0 41.0 16 37.41575 40.0 38.0 41.0 32.0 41.0 17 37.326 40.0 38.0 41.0 32.0 41.0 18 37.24025 40.0 38.0 41.0 32.0 41.0 19 37.1655 40.0 38.0 41.0 31.0 41.0 20 37.31475 40.0 38.0 41.0 32.0 41.0 21 37.234 40.0 38.0 41.0 32.0 41.0 22 37.23175 40.0 38.0 41.0 32.0 41.0 23 37.02525 40.0 38.0 41.0 31.0 41.0 24 37.0835 40.0 38.0 41.0 32.0 41.0 25 37.04 40.0 38.0 41.0 31.0 41.0 26 37.01325 40.0 38.0 41.0 31.0 41.0 27 36.80225 40.0 38.0 41.0 30.0 41.0 28 36.76625 40.0 38.0 41.0 30.0 41.0 29 36.71825 40.0 38.0 41.0 30.0 41.0 30 36.6265 40.0 38.0 41.0 30.0 41.0 31 36.5415 40.0 38.0 41.0 29.0 41.0 32 36.45625 40.0 38.0 41.0 29.0 41.0 33 36.527 40.0 38.0 41.0 30.0 41.0 34 36.37625 40.0 37.0 41.0 29.0 41.0 35 36.40875 40.0 37.0 41.0 30.0 41.0 36 36.14975 40.0 37.0 41.0 27.0 41.0 37 36.02025 40.0 36.0 41.0 28.0 41.0 38 36.08875 40.0 37.0 41.0 28.0 41.0 39 35.92275 40.0 36.0 41.0 27.0 41.0 40 36.0215 40.0 37.0 41.0 28.0 41.0 41 35.887 40.0 36.0 41.0 27.0 41.0 42 35.7875 40.0 36.0 41.0 27.0 41.0 43 35.60325 40.0 36.0 41.0 25.0 41.0 44 35.395 40.0 35.0 41.0 25.0 41.0 45 35.29 40.0 35.0 41.0 24.0 41.0 46 35.01875 40.0 35.0 41.0 23.0 41.0 47 34.85075 40.0 35.0 41.0 22.0 41.0 48 34.5515 39.0 35.0 41.0 19.0 41.0 49 34.623 39.0 35.0 41.0 20.0 41.0 50 33.587 38.0 33.0 40.0 2.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 108.0 3 5.0 4 15.0 5 11.0 6 6.0 7 8.0 8 11.0 9 2.0 10 9.0 11 5.0 12 5.0 13 3.0 14 2.0 15 11.0 16 2.0 17 5.0 18 3.0 19 8.0 20 4.0 21 14.0 22 12.0 23 11.0 24 9.0 25 13.0 26 30.0 27 33.0 28 31.0 29 54.0 30 48.0 31 54.0 32 65.0 33 83.0 34 110.0 35 145.0 36 201.0 37 332.0 38 553.0 39 1979.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.441243366186505 14.101592115238818 9.021986353297953 54.435178165276724 2 19.425 19.400000000000002 38.550000000000004 22.625 3 19.5 22.275 25.05 33.175 4 25.224999999999998 26.075 21.325 27.375 5 27.175 30.075000000000003 21.875 20.875 6 22.275 33.550000000000004 23.95 20.225 7 20.05 23.05 36.15 20.75 8 19.909954977488745 25.012506253126567 31.56578289144572 23.51175587793897 9 21.135567783891947 24.112056028014006 31.915957978989496 22.836418209104554 10 21.410705352676338 35.042521260630316 25.53776888444222 18.009004502251123 11 25.387693846923458 28.83941970985493 21.060530265132567 24.712356178089045 12 23.311655827913956 24.487243621810904 26.813406703351678 25.387693846923458 13 21.215911933950462 27.445584188141105 28.77157868401301 22.566925193895422 14 22.141606204653492 27.645734300725543 27.09532149111834 23.117338003502628 15 22.161080540270135 27.66383191595798 25.737868934467233 24.437218609304654 16 22.611305652826413 26.738369184592298 26.563281640820406 24.087043521760883 17 24.337168584292147 26.8384192096048 25.137568784392194 23.686843421710854 18 23.592694520890667 26.695021265949464 25.894420815611706 23.817863397548162 19 23.554443053817273 26.18272841051314 25.75719649561952 24.505632040050063 20 22.62828535669587 26.68335419274093 26.032540675844807 24.6558197747184 21 23.57947434292866 26.307884856070086 27.033792240300375 23.078848560700877 22 23.128911138923655 26.783479349186486 26.858573216520647 23.229036295369212 23 23.554443053817273 28.11013767209011 25.93241551939925 22.40300375469337 24 23.879849812265334 26.958698372966204 25.18147684605757 23.979974968710888 25 22.728410513141426 26.18272841051314 26.783479349186486 24.30538172715895 26 21.777221526908637 27.784730913642054 26.733416770963704 23.704630788485606 27 23.00375469336671 28.185231539424283 24.58072590738423 24.23028785982478 28 22.197197197197198 28.053053053053052 25.100100100100097 24.64964964964965 29 22.216662496872654 27.32049036777583 26.494871153365025 23.967975981986488 30 24.34325744308231 26.494871153365025 26.46985238929197 22.692019014260694 31 22.441831373530146 25.243932949712285 27.47060295221416 24.843632724543408 32 23.273273273273272 26.351351351351347 26.976976976976978 23.3983983983984 33 23.57947434292866 26.207759699624532 25.20650813516896 25.00625782227785 34 22.60325406758448 27.359198998748436 25.131414267834796 24.90613266583229 35 23.654568210262827 27.083854818523157 26.132665832290364 23.128911138923655 36 24.030037546933666 26.533166458072593 26.382978723404253 23.053817271589487 37 23.092319239429575 26.970227670753065 26.394796097072803 23.54265699274456 38 22.252816020025033 27.25907384230288 27.033792240300375 23.454317897371716 39 23.64864864864865 27.75275275275275 24.2992992992993 24.2992992992993 40 22.35294117647059 28.31038798498123 25.18147684605757 24.155193992490613 41 23.54854854854855 28.103103103103106 26.326326326326328 22.02202202202202 42 22.76707530647986 26.394796097072803 25.293970477858394 25.544158118588946 43 24.105131414267834 26.783479349186486 25.481852315394242 23.62953692115144 44 23.323323323323322 26.901901901901905 26.476476476476474 23.2982982982983 45 23.754693366708384 28.16020025031289 25.982478097622025 22.102628285356694 46 23.729662077597 26.558197747183982 26.733416770963704 22.97872340425532 47 22.503128911138923 27.40926157697122 26.858573216520647 23.229036295369212 48 23.575 25.75 26.400000000000002 24.275 49 23.1 26.275 26.25 24.375 50 22.95 26.3 25.900000000000002 24.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.5 14 2.0 15 1.5 16 1.0 17 3.5 18 6.0 19 4.0 20 2.0 21 5.5 22 9.0 23 11.5 24 14.0 25 16.0 26 18.0 27 25.5 28 33.0 29 39.5 30 46.0 31 62.0 32 78.0 33 110.0 34 142.0 35 154.0 36 166.0 37 203.0 38 240.0 39 277.0 40 314.0 41 326.5 42 339.0 43 353.5 44 368.0 45 363.0 46 358.0 47 329.0 48 300.0 49 315.0 50 330.0 51 302.5 52 275.0 53 240.0 54 205.0 55 200.0 56 195.0 57 161.0 58 127.0 59 110.5 60 94.0 61 81.0 62 68.0 63 52.0 64 36.0 65 38.0 66 40.0 67 36.5 68 33.0 69 36.5 70 40.0 71 42.5 72 45.0 73 47.0 74 49.0 75 30.5 76 12.0 77 9.0 78 6.0 79 4.5 80 3.0 81 2.0 82 1.0 83 2.0 84 3.0 85 2.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.05 9 0.05 10 0.05 11 0.05 12 0.05 13 0.075 14 0.075 15 0.05 16 0.05 17 0.05 18 0.075 19 0.125 20 0.125 21 0.125 22 0.125 23 0.125 24 0.125 25 0.125 26 0.125 27 0.125 28 0.1 29 0.075 30 0.075 31 0.075 32 0.1 33 0.125 34 0.125 35 0.125 36 0.125 37 0.075 38 0.125 39 0.1 40 0.125 41 0.1 42 0.075 43 0.125 44 0.1 45 0.125 46 0.125 47 0.125 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.68320710368242 92.55 2 2.6116479498563594 5.0 3 0.47009663097414467 1.35 4 0.20893183598850876 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026116479498563595 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 12 0.3 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10 0.1 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.1 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.15 0.0 0.0 0.0 0.0 19 0.15 0.0 0.0 0.0 0.0 20 0.175 0.0 0.0 0.0 0.0 21 0.175 0.0 0.0 0.0 0.0 22 0.175 0.0 0.0 0.0 0.0 23 0.175 0.0 0.0 0.0 0.0 24 0.175 0.0 0.0 0.0 0.0 25 0.175 0.0 0.0 0.0 0.0 26 0.175 0.0 0.0 0.0 0.0 27 0.175 0.0 0.0 0.0 0.0 28 0.175 0.0 0.0 0.0 0.0 29 0.175 0.0 0.0 0.0 0.0 30 0.175 0.0 0.0 0.0 0.0 31 0.175 0.0 0.0 0.0 0.0 32 0.175 0.0 0.0 0.0 0.0 33 0.175 0.0 0.0 0.0 0.0 34 0.175 0.0 0.0 0.0 0.0 35 0.175 0.0 0.0 0.0 0.0 36 0.175 0.0 0.0 0.0 0.0 37 0.175 0.0 0.0 0.0 0.0 38 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648488 spots for SRR3317207.sra Written 1648488 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra Read 1648480 spots for SRR3317207.sra Written 1648480 spots for SRR3317207.sra SRR ids: ['SRR3317207.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_px5cav6l SRR3317207.sra spots: 32969608 blocks: [[1, 1648480], [1648481, 3296960], [3296961, 4945440], [4945441, 6593920], [6593921, 8242400], [8242401, 9890880], [9890881, 11539360], [11539361, 13187840], [13187841, 14836320], [14836321, 16484800], [16484801, 18133280], [18133281, 19781760], [19781761, 21430240], [21430241, 23078720], [23078721, 24727200], [24727201, 26375680], [26375681, 28024160], [28024161, 29672640], [29672641, 31321120], [31321121, 32969608]] SRR3317207 file size 5510567 SRR3317207 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317207 SRR3317207_1.fastq Input file: SRR3317207_1.fastq trimmed: SRR3317207-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:05:06 2025 >> started Tue Feb 11 12:05:20 2025 >> done (14.260s) 32969608 reads processed; of these: 619587 ( 1.88%) short reads filtered out after trimming by size control 1106594 ( 3.36%) empty reads filtered out after trimming by size control 31243427 (94.76%) reads available; of these: 2365310 ( 7.57%) trimmed reads available after processing 28878117 (92.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 34965 0.11% 19 28538 0.09% 20 26230 0.08% 21 26412 0.08% 22 27476 0.09% 23 28492 0.09% 24 29844 0.10% 25 32028 0.10% 26 32489 0.10% 27 32615 0.10% 28 34085 0.11% 29 35961 0.12% 30 39122 0.13% 31 40564 0.13% 32 44388 0.14% 33 42158 0.13% 34 46923 0.15% 35 48385 0.15% 36 52393 0.17% 37 54699 0.18% 38 57122 0.18% 39 62265 0.20% 40 68186 0.22% 41 79291 0.25% 42 89150 0.29% 43 99132 0.32% 44 111020 0.36% 45 133035 0.43% 46 161883 0.52% 47 218180 0.70% 48 239934 0.77% 49 308345 0.99% 50 28878117 92.43% 31243427 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=26 prefix-density=0.25 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=81.63 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=12.2 sequence=CTTCTTCTTCTT Started job on | Feb 11 12:05:33 Started mapping on | Feb 11 12:05:34 Finished on | Feb 11 12:06:18 Mapping speed, Million of reads per hour | 2556.28 Number of input reads | 31243427 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 20809039 Uniquely mapped reads % | 66.60% Average mapped length | 49.30 Number of splices: Total | 2808337 Number of splices: Annotated (sjdb) | 2758372 Number of splices: GT/AG | 2758729 Number of splices: GC/AG | 39382 Number of splices: AT/AC | 2782 Number of splices: Non-canonical | 7444 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1340294 % of reads mapped to multiple loci | 4.29% Number of reads mapped to too many loci | 8822813 % of reads mapped to too many loci | 28.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.86% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 9094094 9094094 9094094 N_multimapping 1340294 1340294 1340294 N_noFeature 1099188 10822411 10989803 N_ambiguous 155185 29367 30184 UnstrandedReadsAssigned:19554666 PositiveStrandReadsAssigned:9957261 NegativeStrandReadsAssigned:9789052 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317207 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317207-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,243,427 reads, 26,527,472 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR3317207.ke.tsv 34699 SRR3317207.se.tsv 87100 total ==> SRR3317207.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 673.577 15.1486 Potri.005G024800.1.v4.1 1035 936 75 3.45817 Potri.004G059700.1.v4.1 961 862 242 12.1163 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 805.607 12.2252 Potri.016G087400.1.v4.1 270 171 1153.98 291.248 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 7 0.180469 Potri.012G127500.1.v4.1 977 878 32776 1611.1 ==> SRR3317207.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 342 Potri.001G233950.v4.1 7 Potri.001G122700.v4.1 440 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 5 SRR3317207 completed mapping pipeline successfully