Starting /dee2/code/volunteer_pipeline.sh SRR3317208 current disk space = 3051227914240 free memory = 1576946896 SRR3317208 SRAfilesize 7c95af186bebccc417a2a90511676d52 SRR3317208.sra SRR3317208.sra file validated SRR3317208 is single end SRR3317208 is conventional basespace SRR3317208 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317208_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3015 34.0 31.0 34.0 28.0 34.0 2 31.58325 34.0 31.0 34.0 28.0 34.0 3 31.71525 34.0 31.0 34.0 28.0 34.0 4 34.998 37.0 35.0 37.0 32.0 37.0 5 35.01375 37.0 35.0 37.0 32.0 37.0 6 34.895 37.0 35.0 37.0 32.0 37.0 7 34.85425 37.0 35.0 37.0 32.0 37.0 8 34.84275 37.0 35.0 37.0 32.0 37.0 9 36.509 39.0 37.0 39.0 33.0 39.0 10 36.28325 39.0 37.0 39.0 32.0 39.0 11 36.22525 39.0 37.0 39.0 32.0 39.0 12 36.21175 39.0 37.0 39.0 32.0 39.0 13 36.33075 39.0 37.0 39.0 32.0 39.0 14 37.769 41.0 38.0 41.0 33.0 41.0 15 37.5885 40.0 38.0 41.0 32.0 41.0 16 37.64725 41.0 38.0 41.0 32.0 41.0 17 37.6195 40.0 38.0 41.0 32.0 41.0 18 37.5665 40.0 38.0 41.0 32.0 41.0 19 37.49825 40.0 38.0 41.0 32.0 41.0 20 37.4255 40.0 38.0 41.0 32.0 41.0 21 37.473 40.0 38.0 41.0 32.0 41.0 22 37.53725 40.0 39.0 41.0 32.0 41.0 23 37.35975 40.0 38.0 41.0 32.0 41.0 24 37.30925 40.0 38.0 41.0 32.0 41.0 25 37.4085 40.0 38.0 41.0 32.0 41.0 26 37.349 40.0 38.0 41.0 32.0 41.0 27 37.07975 40.0 38.0 41.0 31.0 41.0 28 37.23225 40.0 38.0 41.0 31.0 41.0 29 37.0265 40.0 38.0 41.0 31.0 41.0 30 37.07375 40.0 38.0 41.0 31.0 41.0 31 36.9955 40.0 38.0 41.0 31.0 41.0 32 36.94425 40.0 38.0 41.0 30.0 41.0 33 36.98 40.0 38.0 41.0 30.0 41.0 34 36.895 40.0 38.0 41.0 30.0 41.0 35 36.8405 40.0 38.0 41.0 30.0 41.0 36 36.75025 40.0 38.0 41.0 30.0 41.0 37 36.72925 40.0 37.0 41.0 30.0 41.0 38 36.746 40.0 38.0 41.0 30.0 41.0 39 36.5625 40.0 37.0 41.0 30.0 41.0 40 36.4805 40.0 37.0 41.0 30.0 41.0 41 36.3465 40.0 37.0 41.0 30.0 41.0 42 36.4375 40.0 37.0 41.0 30.0 41.0 43 36.1975 40.0 37.0 41.0 29.0 41.0 44 36.26225 40.0 37.0 41.0 29.0 41.0 45 36.12425 40.0 37.0 41.0 29.0 41.0 46 35.72 40.0 36.0 41.0 27.0 41.0 47 35.7245 40.0 36.0 41.0 28.0 41.0 48 35.47675 40.0 36.0 41.0 26.0 41.0 49 35.494 40.0 36.0 41.0 26.0 41.0 50 34.3905 39.0 34.0 40.0 21.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 88.0 3 2.0 4 13.0 5 8.0 6 6.0 7 7.0 8 9.0 9 2.0 10 5.0 11 6.0 12 6.0 13 7.0 14 2.0 15 5.0 16 6.0 17 8.0 18 5.0 19 12.0 20 8.0 21 5.0 22 8.0 23 10.0 24 9.0 25 15.0 26 18.0 27 23.0 28 31.0 29 49.0 30 35.0 31 59.0 32 67.0 33 83.0 34 95.0 35 141.0 36 190.0 37 327.0 38 588.0 39 2042.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.968852874145355 16.231957457584198 10.053178019751837 46.74601164851862 2 19.75 21.075 35.8 23.375 3 20.175 22.775000000000002 27.950000000000003 29.099999999999998 4 23.355838959739934 28.982245561390346 21.280320080020005 26.38159539884971 5 26.375 31.65 22.15 19.825 6 21.785892946473236 36.418209104552275 22.936468234117058 18.859429714857427 7 18.25912956478239 25.46273136568284 38.444222111055524 17.83391695847924 8 18.8141105829372 26.044533400050035 31.77383037277958 23.367525644233176 9 21.246246246246248 23.14814814814815 32.25725725725725 23.34834834834835 10 18.843843843843842 37.787787787787785 26.901901901901905 16.466466466466468 11 25.243932949712285 30.297723292469353 22.441831373530146 22.016512384288216 12 21.146146146146148 26.676676676676674 27.45245245245245 24.724724724724727 13 20.450563204005007 29.386733416770966 28.085106382978726 22.07759699624531 14 21.376720901126408 29.036295369211512 27.23404255319149 22.35294117647059 15 21.371371371371374 29.77977977977978 26.026026026026027 22.822822822822822 16 22.17217217217217 28.003003003003002 24.774774774774773 25.05005005005005 17 23.3983983983984 27.802802802802802 27.227227227227228 21.57157157157157 18 22.95369211514393 27.25907384230288 27.909887359198997 21.877346683354194 19 20.941883767535067 29.734468937875754 26.302605210420843 23.021042084168336 20 22.283425137706562 28.01702553830746 28.993490235353033 20.70605908863295 21 22.959439158738107 27.766649974962444 27.215823735603408 22.058087130696045 22 21.763085399449036 30.60355622339093 25.519659403956922 22.113698973203107 23 22.458688032048073 29.44416624937406 25.913870806209317 22.183274912368553 24 20.61623246492986 29.258517034068138 25.926853707414832 24.19839679358717 25 21.362384172301528 28.49987478086652 29.226145755071375 20.91159529176058 26 22.344689378757515 27.55511022044088 26.402805611222448 23.697394789579157 27 20.66633266533066 29.03306613226453 26.57815631262525 23.72244488977956 28 21.026282853566958 28.685857321652065 28.6107634543179 21.67709637046308 29 23.178973717146434 28.81101376720901 26.282853566958696 21.727158948685858 30 21.877346683354194 27.80976220275344 27.83479349186483 22.478097622027533 31 21.727158948685858 28.53566958698373 25.20650813516896 24.53066332916145 32 21.35168961201502 30.337922403003752 26.633291614518146 21.67709637046308 33 22.26396193338342 26.79689456548961 27.67342849987478 23.26571500125219 34 20.86673346693387 27.204408817635272 27.229458917835668 24.69939879759519 35 22.158237356034054 26.71507260891337 29.86980470706059 21.256885327991988 36 21.9438877755511 26.47795591182365 29.959919839679362 21.618236472945892 37 24.055068836045056 26.83354192740926 27.53441802252816 21.576971214017522 38 22.389181066867017 27.498121712997747 29.10092662158778 21.011770598547457 39 21.357035553329993 28.768152228342515 27.341011517275916 22.533800701051575 40 20.010017530678688 31.004257450538443 26.67167543200601 22.31404958677686 41 21.8523153942428 28.936170212765955 28.6107634543179 20.600750938673343 42 21.8523153942428 27.80976220275344 26.18272841051314 24.155193992490613 43 19.664328657314627 28.006012024048093 29.63426853707415 22.695390781563127 44 21.727158948685858 27.83479349186483 27.684605757196497 22.753441802252816 45 22.814926120711245 27.39794640621087 26.972201352366643 22.814926120711245 46 22.138742799899823 27.372902579514154 29.151014274981218 21.337340345604808 47 23.09619238476954 29.13326653306613 25.776553106212425 21.993987975951903 48 21.425 27.975 28.65 21.95 49 22.675 27.950000000000003 27.425 21.95 50 22.025 27.474999999999998 27.650000000000002 22.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.5 6 3.0 7 1.5 8 0.0 9 1.0 10 2.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 3.0 18 4.0 19 4.5 20 5.0 21 4.5 22 4.0 23 11.5 24 19.0 25 26.5 26 34.0 27 54.0 28 74.0 29 72.5 30 71.0 31 90.0 32 109.0 33 141.0 34 173.0 35 194.5 36 216.0 37 250.5 38 285.0 39 295.0 40 305.0 41 344.0 42 383.0 43 391.0 44 399.0 45 390.5 46 382.0 47 372.0 48 362.0 49 361.5 50 361.0 51 296.5 52 232.0 53 196.5 54 161.0 55 147.5 56 134.0 57 107.0 58 80.0 59 68.5 60 57.0 61 49.0 62 41.0 63 32.5 64 24.0 65 19.0 66 14.0 67 13.0 68 12.0 69 14.0 70 16.0 71 15.5 72 15.0 73 12.0 74 9.0 75 7.5 76 6.0 77 4.0 78 2.0 79 2.5 80 3.0 81 1.5 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.025 5 0.0 6 0.05 7 0.05 8 0.075 9 0.1 10 0.1 11 0.075 12 0.1 13 0.125 14 0.125 15 0.1 16 0.1 17 0.1 18 0.125 19 0.2 20 0.15 21 0.15 22 0.17500000000000002 23 0.15 24 0.2 25 0.17500000000000002 26 0.2 27 0.2 28 0.125 29 0.125 30 0.125 31 0.125 32 0.125 33 0.17500000000000002 34 0.2 35 0.15 36 0.2 37 0.125 38 0.17500000000000002 39 0.15 40 0.17500000000000002 41 0.125 42 0.125 43 0.2 44 0.125 45 0.17500000000000002 46 0.17500000000000002 47 0.2 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.07502569373074 96.39999999999999 2 0.7965056526207606 1.55 3 0.07708119218910585 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025693730729701953 0.325 >50 0.025693730729701953 1.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 60 1.5 TruSeq Adapter, Index 12 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATG 13 0.325 TruSeq Adapter, Index 12 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.375 0.0 0.0 0.0 0.0 2 0.375 0.0 0.0 0.0 0.0 3 0.375 0.0 0.0 0.0 0.0 4 0.375 0.0 0.0 0.0 0.0 5 0.375 0.0 0.0 0.0 0.0 6 0.375 0.0 0.0 0.0 0.0 7 0.375 0.0 0.0 0.0 0.0 8 0.375 0.0 0.0 0.0 0.0 9 0.375 0.0 0.0 0.0 0.0 10 0.375 0.0 0.0 0.0 0.0 11 0.375 0.0 0.0 0.0 0.0 12 0.375 0.0 0.0 0.0 0.0 13 0.375 0.0 0.0 0.0 0.0 14 0.375 0.0 0.0 0.0 0.0 15 0.375 0.0 0.0 0.0 0.0 16 0.375 0.0 0.0 0.0 0.0 17 0.375 0.0 0.0 0.0 0.0 18 0.375 0.0 0.0 0.0 0.0 19 0.375 0.0 0.0 0.0 0.0 20 0.375 0.0 0.0 0.0 0.0 21 0.375 0.0 0.0 0.0 0.0 22 0.375 0.0 0.0 0.0 0.0 23 0.375 0.0 0.0 0.0 0.0 24 0.375 0.0 0.0 0.0 0.0 25 0.375 0.0 0.0 0.0 0.0 26 0.375 0.0 0.0 0.0 0.0 27 0.375 0.0 0.0 0.0 0.0 28 0.375 0.0 0.0 0.0 0.0 29 0.375 0.0 0.0 0.0 0.0 30 0.375 0.0 0.0 0.0 0.0 31 0.375 0.0 0.0 0.0 0.0 32 0.375 0.0 0.0 0.0 0.0 33 0.375 0.0 0.0 0.0 0.0 34 0.375 0.0 0.0 0.0 0.0 35 0.375 0.0 0.0 0.0 0.0 36 0.375 0.0 0.0 0.0 0.0 37 0.375 0.0 0.0 0.0 0.0 38 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739035 spots for SRR3317208.sra Written 1739035 spots for SRR3317208.sra Read 1739038 spots for SRR3317208.sra Written 1739038 spots for SRR3317208.sra SRR ids: ['SRR3317208.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ziz2jzo8 SRR3317208.sra spots: 34780703 blocks: [[1, 1739035], [1739036, 3478070], [3478071, 5217105], [5217106, 6956140], [6956141, 8695175], [8695176, 10434210], [10434211, 12173245], [12173246, 13912280], [13912281, 15651315], [15651316, 17390350], [17390351, 19129385], [19129386, 20868420], [20868421, 22607455], [22607456, 24346490], [24346491, 26085525], [26085526, 27824560], [27824561, 29563595], [29563596, 31302630], [31302631, 33041665], [33041666, 34780703]] SRR3317208 file size 5813866 SRR3317208 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317208 SRR3317208_1.fastq Input file: SRR3317208_1.fastq trimmed: SRR3317208-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:04:21 2025 >> started Tue Feb 11 12:04:36 2025 >> done (14.733s) 34780703 reads processed; of these: 558097 ( 1.60%) short reads filtered out after trimming by size control 1620918 ( 4.66%) empty reads filtered out after trimming by size control 32601688 (93.73%) reads available; of these: 2044360 ( 6.27%) trimmed reads available after processing 30557328 (93.73%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 29880 0.09% 19 23710 0.07% 20 21768 0.07% 21 22046 0.07% 22 22745 0.07% 23 23354 0.07% 24 23871 0.07% 25 24759 0.08% 26 25484 0.08% 27 26449 0.08% 28 27355 0.08% 29 28634 0.09% 30 30272 0.09% 31 32113 0.10% 32 34485 0.11% 33 34525 0.11% 34 37266 0.11% 35 38922 0.12% 36 41441 0.13% 37 44912 0.14% 38 47831 0.15% 39 51624 0.16% 40 57840 0.18% 41 64654 0.20% 42 75459 0.23% 43 83663 0.26% 44 96943 0.30% 45 116540 0.36% 46 143554 0.44% 47 198662 0.61% 48 220539 0.68% 49 293060 0.90% 50 30557328 93.73% 32601688 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=19 prefix-density=0.08 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=6 fanout-score=34.68 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=11.0 sequence=CCACCACCAGCAAC Started job on | Feb 11 12:04:48 Started mapping on | Feb 11 12:04:48 Finished on | Feb 11 12:05:24 Mapping speed, Million of reads per hour | 3260.17 Number of input reads | 32601688 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 27887207 Uniquely mapped reads % | 85.54% Average mapped length | 49.31 Number of splices: Total | 2877809 Number of splices: Annotated (sjdb) | 2825741 Number of splices: GT/AG | 2834490 Number of splices: GC/AG | 31663 Number of splices: AT/AC | 2585 Number of splices: Non-canonical | 9071 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 1.65 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1395477 % of reads mapped to multiple loci | 4.28% Number of reads mapped to too many loci | 3003377 % of reads mapped to too many loci | 9.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.95% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3319004 3319004 3319004 N_multimapping 1395477 1395477 1395477 N_noFeature 1396534 14406063 14677808 N_ambiguous 282451 40456 42514 UnstrandedReadsAssigned:26208222 PositiveStrandReadsAssigned:13440688 NegativeStrandReadsAssigned:13166885 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317208 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317208-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,601,688 reads, 27,956,074 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 SRR3317208.ke.tsv 34699 SRR3317208.se.tsv 87100 total ==> SRR3317208.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 541.5 12.5541 Potri.005G024800.1.v4.1 1035 936 43 2.04388 Potri.004G059700.1.v4.1 961 862 105.886 5.46502 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 398.344 6.23148 Potri.016G087400.1.v4.1 270 171 1975.35 513.937 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 37.7547 1.00341 Potri.012G127500.1.v4.1 977 878 5272 267.143 ==> SRR3317208.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3432 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3317208 completed mapping pipeline successfully