Starting /dee2/code/volunteer_pipeline.sh SRR3317473 current disk space = 3051483353088 free memory = 1486369716 SRR3317473 SRAfilesize 6c1082973b6b007e75800e0cd65eeae8 SRR3317473.sra SRR3317473.sra file validated SRR3317473 is single end SRR3317473 is conventional basespace SRR3317473 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317473_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.363 34.0 31.0 34.0 28.0 34.0 2 31.4895 34.0 31.0 34.0 28.0 34.0 3 31.638 34.0 31.0 34.0 28.0 34.0 4 35.05775 37.0 35.0 37.0 32.0 37.0 5 35.00225 37.0 35.0 37.0 32.0 37.0 6 34.926 37.0 35.0 37.0 32.0 37.0 7 34.99125 37.0 35.0 37.0 32.0 37.0 8 34.845 37.0 35.0 37.0 32.0 37.0 9 36.448 39.0 37.0 39.0 32.0 39.0 10 36.44375 39.0 37.0 39.0 32.0 39.0 11 36.40025 39.0 37.0 39.0 32.0 39.0 12 36.1715 39.0 37.0 39.0 32.0 39.0 13 36.23 39.0 37.0 39.0 32.0 39.0 14 37.54375 40.0 38.0 41.0 32.0 41.0 15 37.4315 40.0 38.0 41.0 32.0 41.0 16 37.389 40.0 38.0 41.0 32.0 41.0 17 37.23975 40.0 38.0 41.0 32.0 41.0 18 37.28275 40.0 38.0 41.0 31.0 41.0 19 37.33525 40.0 38.0 41.0 32.0 41.0 20 37.139 40.0 38.0 41.0 31.0 41.0 21 37.142 40.0 38.0 41.0 31.0 41.0 22 37.11275 40.0 38.0 41.0 30.0 41.0 23 36.9125 40.0 38.0 41.0 30.0 41.0 24 37.06025 40.0 38.0 41.0 31.0 41.0 25 36.9425 40.0 38.0 41.0 30.0 41.0 26 36.878 40.0 38.0 41.0 30.0 41.0 27 36.90475 40.0 38.0 41.0 30.0 41.0 28 36.56275 40.0 38.0 41.0 29.0 41.0 29 36.57825 40.0 38.0 41.0 30.0 41.0 30 36.59375 40.0 38.0 41.0 30.0 41.0 31 36.40525 40.0 37.0 41.0 29.0 41.0 32 36.184 40.0 37.0 41.0 28.0 41.0 33 36.2755 40.0 37.0 41.0 29.0 41.0 34 35.343 40.0 35.0 41.0 24.0 41.0 35 35.65875 40.0 36.0 41.0 26.0 41.0 36 35.846 40.0 36.0 41.0 27.0 41.0 37 35.77275 40.0 36.0 41.0 26.0 41.0 38 35.8495 40.0 36.0 41.0 27.0 41.0 39 35.8015 40.0 36.0 41.0 27.0 41.0 40 35.30775 40.0 35.0 41.0 24.0 41.0 41 35.245 40.0 35.0 41.0 24.0 41.0 42 35.2675 40.0 35.0 41.0 24.0 41.0 43 35.28375 40.0 35.0 41.0 24.0 41.0 44 35.16775 40.0 35.0 41.0 24.0 41.0 45 34.90325 40.0 35.0 41.0 22.0 41.0 46 34.791 40.0 35.0 41.0 21.0 41.0 47 34.31325 39.0 34.0 41.0 18.0 41.0 48 34.1435 39.0 34.0 41.0 9.0 41.0 49 33.72275 39.0 34.0 41.0 2.0 41.0 50 32.738 38.0 32.0 40.0 2.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 70.0 3 5.0 4 14.0 5 10.0 6 13.0 7 10.0 8 9.0 9 12.0 10 9.0 11 6.0 12 6.0 13 8.0 14 9.0 15 8.0 16 10.0 17 4.0 18 13.0 19 9.0 20 18.0 21 10.0 22 14.0 23 18.0 24 16.0 25 23.0 26 26.0 27 36.0 28 32.0 29 35.0 30 58.0 31 65.0 32 69.0 33 80.0 34 106.0 35 143.0 36 236.0 37 369.0 38 648.0 39 1773.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.413400758533502 15.802781289506953 9.051833122629581 51.73198482932996 2 21.65 17.974999999999998 35.55 24.825 3 20.549999999999997 22.75 23.7 33.0 4 25.874999999999996 26.424999999999997 19.825 27.875 5 27.900000000000002 30.475 21.175 20.45 6 23.400000000000002 34.825 21.675 20.1 7 21.05 21.6 37.15 20.200000000000003 8 20.45 23.025000000000002 30.375000000000004 26.150000000000002 9 22.3 21.875 31.6 24.224999999999998 10 21.375 35.675000000000004 23.75 19.2 11 26.625 27.275 20.1 26.0 12 23.150000000000002 24.349999999999998 25.45 27.05 13 23.175 26.5 27.575 22.75 14 22.605651412853213 26.481620405101275 27.106776694173547 23.80595148787197 15 24.95 25.55 25.45 24.05 16 24.425 25.124999999999996 25.45 25.0 17 24.75 25.974999999999998 24.7 24.575 18 23.455863965991497 25.756439109777446 25.85646411602901 24.93123280820205 19 24.637318659329665 27.113556778389196 25.512756378189096 22.736368184092047 20 24.362181090545274 25.162581290645324 26.538269134567283 23.936968484242122 21 23.7987987987988 25.7007007007007 26.626626626626624 23.873873873873876 22 22.311155577788895 27.313656828414207 26.163081540770385 24.212106053026513 23 24.668501376032022 25.31898924193145 26.319739804853644 23.692769577182887 24 24.055068836045056 24.680851063829788 26.633291614518146 24.63078848560701 25 23.473473473473476 25.75075075075075 26.45145145145145 24.324324324324326 26 23.6986986986987 27.2022022022022 24.774774774774773 24.324324324324326 27 23.623623623623622 26.75175175175175 25.25025025025025 24.374374374374376 28 23.386693346673336 26.988494247123562 25.887943971985994 23.736868434217108 29 24.262131065532767 26.513256628314156 26.063031515757878 23.1615807903952 30 25.93148287071768 25.55638909727432 25.28132033008252 23.23080770192548 31 23.761880940470235 25.312656328164078 26.513256628314156 24.412206103051524 32 23.330832708177045 26.60665166291573 25.581395348837212 24.48112028007002 33 24.637318659329665 26.113056528264135 24.512256128064035 24.73736868434217 34 22.54190642982237 26.51988991743808 26.344758568926697 24.59344508381286 35 23.723723723723726 26.176176176176174 26.026026026026027 24.074074074074073 36 24.818613960470355 25.74430823117338 25.619214410808105 23.817863397548162 37 22.911455727863935 27.48874437218609 26.663331665832917 22.936468234117058 38 23.78689344672336 25.587793896948476 26.18809404702351 24.437218609304654 39 23.51175587793897 27.813906953476735 24.96248124062031 23.71185592796398 40 23.730932733183295 27.081770442610654 25.406351587896975 23.78094523630908 41 24.112056028014006 26.263131565782892 26.513256628314156 23.111555777888945 42 24.4994994994995 26.126126126126124 25.475475475475474 23.8988988988989 43 22.54190642982237 26.670002501876404 26.26970227670753 24.518388791593697 44 24.462231115557778 26.013006503251624 26.21310655327664 23.311655827913956 45 23.91793845384038 26.069552164123095 26.56992744558419 23.44258193645234 46 24.324324324324326 24.924924924924923 25.350350350350347 25.400400400400404 47 24.774774774774773 27.25225225225225 24.7997997997998 23.173173173173172 48 24.93116395494368 25.60700876095119 24.85607008760951 24.60575719649562 49 23.325000000000003 25.900000000000002 27.175 23.599999999999998 50 22.175 26.674999999999997 25.525 25.624999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 2.0 20 3.0 21 2.0 22 1.0 23 4.5 24 8.0 25 12.0 26 16.0 27 24.0 28 32.0 29 33.0 30 34.0 31 57.0 32 80.0 33 94.0 34 108.0 35 121.0 36 134.0 37 164.5 38 195.0 39 243.5 40 292.0 41 321.0 42 350.0 43 346.5 44 343.0 45 345.0 46 347.0 47 343.0 48 339.0 49 343.5 50 348.0 51 313.5 52 279.0 53 244.0 54 209.0 55 210.5 56 212.0 57 176.0 58 140.0 59 130.0 60 120.0 61 94.0 62 68.0 63 66.0 64 64.0 65 49.0 66 34.0 67 36.0 68 38.0 69 42.0 70 46.0 71 52.5 72 59.0 73 55.0 74 51.0 75 35.0 76 19.0 77 14.5 78 10.0 79 9.0 80 8.0 81 7.0 82 6.0 83 4.0 84 2.0 85 2.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.025 15 0.0 16 0.0 17 0.0 18 0.025 19 0.05 20 0.05 21 0.1 22 0.05 23 0.075 24 0.125 25 0.1 26 0.1 27 0.1 28 0.05 29 0.05 30 0.025 31 0.05 32 0.025 33 0.05 34 0.075 35 0.1 36 0.075 37 0.05 38 0.05 39 0.05 40 0.025 41 0.05 42 0.1 43 0.075 44 0.05 45 0.075 46 0.1 47 0.1 48 0.125 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 95.10956707642971 88.97500000000001 2 3.687867450561197 6.9 3 0.774986638161411 2.175 4 0.2405130946018172 0.8999999999999999 5 0.10689470871191875 0.5 6 0.053447354355959376 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026723677177979688 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 10 0.25 TruSeq Adapter, Index 13 (97% over 40bp) CCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCC 6 0.15 No Hit CTTGTTACGACTTCTCCTTCCTCTAAATGATAAGGTTCAGTGGACTTCTC 6 0.15 No Hit CTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTT 5 0.125 No Hit CTCCGATTCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCAC 5 0.125 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAA 5 0.125 No Hit AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTA 5 0.125 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.125 0.0 0.0 0.0 0.0 20 0.125 0.0 0.0 0.0 0.0 21 0.125 0.0 0.0 0.0 0.0 22 0.125 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.125 0.0 0.0 0.0 0.0 26 0.125 0.0 0.0 0.0 0.0 27 0.125 0.0 0.0 0.0 0.0 28 0.125 0.0 0.0 0.0 0.0 29 0.125 0.0 0.0 0.0 0.0 30 0.125 0.0 0.0 0.0 0.0 31 0.125 0.0 0.0 0.0 0.0 32 0.125 0.0 0.0 0.0 0.0 33 0.125 0.0 0.0 0.0 0.0 34 0.125 0.0 0.0 0.0 0.0 35 0.125 0.0 0.0 0.0 0.0 36 0.125 0.0 0.0 0.0 0.0 37 0.125 0.0 0.0 0.0 0.0 38 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878648 spots for SRR3317473.sra Written 1878648 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra Read 1878635 spots for SRR3317473.sra Written 1878635 spots for SRR3317473.sra SRR ids: ['SRR3317473.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mniehmis SRR3317473.sra spots: 37572713 blocks: [[1, 1878635], [1878636, 3757270], [3757271, 5635905], [5635906, 7514540], [7514541, 9393175], [9393176, 11271810], [11271811, 13150445], [13150446, 15029080], [15029081, 16907715], [16907716, 18786350], [18786351, 20664985], [20664986, 22543620], [22543621, 24422255], [24422256, 26300890], [26300891, 28179525], [28179526, 30058160], [30058161, 31936795], [31936796, 33815430], [33815431, 35694065], [35694066, 37572713]] SRR3317473 file size 6281438 SRR3317473 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317473 SRR3317473_1.fastq Input file: SRR3317473_1.fastq trimmed: SRR3317473-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:40:55 2025 >> started Tue Feb 11 11:41:10 2025 >> done (15.645s) 37572713 reads processed; of these: 827793 ( 2.20%) short reads filtered out after trimming by size control 1094885 ( 2.91%) empty reads filtered out after trimming by size control 35650035 (94.88%) reads available; of these: 3096257 ( 8.69%) trimmed reads available after processing 32553778 (91.31%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 39446 0.11% 19 36944 0.10% 20 34093 0.10% 21 33569 0.09% 22 35431 0.10% 23 37522 0.11% 24 40276 0.11% 25 43893 0.12% 26 45522 0.13% 27 44575 0.13% 28 44642 0.13% 29 47425 0.13% 30 52113 0.15% 31 53067 0.15% 32 58549 0.16% 33 55087 0.15% 34 61478 0.17% 35 63517 0.18% 36 68617 0.19% 37 70627 0.20% 38 73918 0.21% 39 79430 0.22% 40 87188 0.24% 41 102341 0.29% 42 114219 0.32% 43 129406 0.36% 44 145633 0.41% 45 172640 0.48% 46 215596 0.60% 47 323605 0.91% 48 304629 0.85% 49 381259 1.07% 50 32553778 91.31% 35650035 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=53.04 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.2 sequence=AGAAGAAGAGAAGCC Started job on | Feb 11 11:41:25 Started mapping on | Feb 11 11:41:25 Finished on | Feb 11 11:42:20 Mapping speed, Million of reads per hour | 2333.46 Number of input reads | 35650035 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 20741992 Uniquely mapped reads % | 58.18% Average mapped length | 49.29 Number of splices: Total | 2844877 Number of splices: Annotated (sjdb) | 2797259 Number of splices: GT/AG | 2796214 Number of splices: GC/AG | 39002 Number of splices: AT/AC | 2585 Number of splices: Non-canonical | 7076 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.02% Deletion average length | 1.68 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1370612 % of reads mapped to multiple loci | 3.84% Number of reads mapped to too many loci | 13147759 % of reads mapped to too many loci | 36.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 13537431 13537431 13537431 N_multimapping 1370612 1370612 1370612 N_noFeature 1080041 10793526 10937193 N_ambiguous 149229 28783 29417 UnstrandedReadsAssigned:19512722 PositiveStrandReadsAssigned:9919683 NegativeStrandReadsAssigned:9775382 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317473 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317473-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,650,035 reads, 29,947,961 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52401 SRR3317473.ke.tsv 34699 SRR3317473.se.tsv 87100 total ==> SRR3317473.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 768 15.6194 Potri.005G024800.1.v4.1 1035 936 74.0067 3.08585 Potri.004G059700.1.v4.1 961 862 197 8.91945 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 668.617 9.17544 Potri.016G087400.1.v4.1 270 171 1031.98 235.533 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 39 0.909261 Potri.012G127500.1.v4.1 977 878 28663 1274.11 ==> SRR3317473.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 436 Potri.001G233950.v4.1 8 Potri.001G122700.v4.1 499 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 10 SRR3317473 completed mapping pipeline successfully