Starting /dee2/code/volunteer_pipeline.sh SRR3317474 current disk space = 3051561574400 free memory = 1506501272 SRR3317474 SRAfilesize a14182c58a48d4163de5ced9b4d16575 SRR3317474.sra SRR3317474.sra file validated SRR3317474 is single end SRR3317474 is conventional basespace SRR3317474 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317474_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.36275 34.0 31.0 34.0 28.0 34.0 2 31.526 34.0 31.0 34.0 27.0 34.0 3 31.75075 34.0 31.0 34.0 28.0 34.0 4 35.16625 37.0 35.0 37.0 32.0 37.0 5 35.1735 37.0 35.0 37.0 32.0 37.0 6 35.02125 37.0 35.0 37.0 32.0 37.0 7 35.02875 37.0 35.0 37.0 32.0 37.0 8 34.9645 37.0 35.0 37.0 32.0 37.0 9 36.64675 39.0 37.0 39.0 32.0 39.0 10 36.492 39.0 37.0 39.0 32.0 39.0 11 36.45225 39.0 37.0 39.0 32.0 39.0 12 36.205 39.0 37.0 39.0 32.0 39.0 13 36.36725 39.0 37.0 39.0 32.0 39.0 14 37.6855 40.0 38.0 41.0 32.0 41.0 15 37.44625 40.0 38.0 41.0 32.0 41.0 16 37.5265 40.0 38.0 41.0 32.0 41.0 17 37.37625 40.0 38.0 41.0 32.0 41.0 18 37.4995 40.0 38.0 41.0 32.0 41.0 19 37.4235 40.0 38.0 41.0 31.0 41.0 20 37.27075 40.0 38.0 41.0 31.0 41.0 21 37.122 40.0 38.0 41.0 31.0 41.0 22 37.14425 40.0 38.0 41.0 31.0 41.0 23 36.8135 40.0 38.0 41.0 30.0 41.0 24 36.9765 40.0 38.0 41.0 31.0 41.0 25 36.90575 40.0 38.0 41.0 30.0 41.0 26 36.87 40.0 38.0 41.0 31.0 41.0 27 36.75325 40.0 38.0 41.0 30.0 41.0 28 36.5225 40.0 38.0 41.0 30.0 41.0 29 36.463 40.0 37.0 41.0 29.0 41.0 30 36.41475 40.0 37.0 41.0 29.0 41.0 31 36.34125 40.0 37.0 41.0 30.0 41.0 32 36.23175 40.0 37.0 41.0 29.0 41.0 33 36.13025 40.0 37.0 41.0 28.0 41.0 34 35.0775 40.0 35.0 41.0 23.0 41.0 35 35.50075 40.0 36.0 41.0 25.0 41.0 36 35.6655 40.0 36.0 41.0 27.0 41.0 37 35.57175 40.0 36.0 41.0 25.0 41.0 38 35.57525 40.0 36.0 41.0 26.0 41.0 39 35.56025 40.0 36.0 41.0 26.0 41.0 40 35.1535 40.0 35.0 41.0 24.0 41.0 41 34.99475 40.0 35.0 41.0 23.0 41.0 42 34.925 39.0 35.0 41.0 23.0 41.0 43 34.9305 39.0 35.0 41.0 23.0 41.0 44 34.707 39.0 35.0 41.0 21.0 41.0 45 34.49875 39.0 35.0 41.0 20.0 41.0 46 34.2835 39.0 35.0 41.0 15.0 41.0 47 33.87025 39.0 34.0 41.0 8.0 41.0 48 33.62125 39.0 34.0 41.0 2.0 41.0 49 33.2635 38.0 33.0 41.0 2.0 41.0 50 32.16975 38.0 32.0 40.0 2.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 62.0 3 5.0 4 19.0 5 8.0 6 10.0 7 8.0 8 9.0 9 8.0 10 11.0 11 8.0 12 16.0 13 7.0 14 6.0 15 7.0 16 13.0 17 9.0 18 17.0 19 13.0 20 5.0 21 17.0 22 18.0 23 18.0 24 16.0 25 27.0 26 24.0 27 30.0 28 26.0 29 41.0 30 53.0 31 48.0 32 84.0 33 104.0 34 110.0 35 174.0 36 249.0 37 410.0 38 650.0 39 1660.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.692015209125476 12.902408111533587 8.79594423320659 51.60963244613435 2 23.1 16.975 34.375 25.55 3 21.375 19.85 24.7 34.075 4 25.95 26.0 18.775 29.275000000000002 5 27.425 29.825000000000003 21.6 21.15 6 25.0 32.475 22.15 20.375 7 21.175 22.125 36.025 20.674999999999997 8 21.75 21.625 30.099999999999998 26.525 9 22.930732683170792 21.8304576144036 30.15753938484621 25.081270317579396 10 22.355588897224308 34.7586896724181 24.15603900975244 18.72968242060515 11 26.5 25.825 21.45 26.224999999999998 12 23.80595148787197 22.95573893473368 26.60665166291573 26.63165791447862 13 22.53063265816454 26.65666416604151 27.60690172543136 23.20580145036259 14 23.330832708177045 26.506626656664167 24.93123280820205 25.23130782695674 15 24.431107776944234 25.581395348837212 26.006501625406354 23.980995248812203 16 24.10602650662666 25.756439109777446 24.10602650662666 26.03150787696924 17 24.831207801950487 25.55638909727432 25.93148287071768 23.680920230057513 18 23.88694347173587 26.388194097048522 26.23811905952976 23.486743371685844 19 24.043032274205654 25.11883912934701 26.194645984488368 24.64348261195897 20 24.387193596798397 26.18809404702351 24.7623811905953 24.662331165582792 21 24.468351263447584 26.044533400050035 26.019514635976982 23.46760070052539 22 25.293970477858394 24.943707780835627 24.818613960470355 24.943707780835627 23 24.86865148861646 26.64498373780335 23.942957217913435 24.54340755566675 24 24.274274274274273 26.126126126126124 25.075075075075077 24.524524524524523 25 24.324324324324326 26.101101101101097 24.124124124124123 25.45045045045045 26 25.0 26.126126126126124 24.474474474474476 24.3993993993994 27 24.218163622717036 25.494120590442833 25.268951713785338 25.01876407305479 28 23.81190595297649 26.263131565782892 25.362681340670335 24.562281140570285 29 24.83741870935468 26.76338169084542 25.83791895947974 22.56128064032016 30 25.76288144072036 24.58729364682341 26.013006503251624 23.6368184092046 31 22.892169126845133 24.96872654490868 24.96872654490868 27.1703777833375 32 24.312156078039017 26.513256628314156 25.86293146573287 23.311655827913956 33 24.168126094570926 26.019514635976982 24.093069802351764 25.719289467100324 34 24.093069802351764 25.894420815611706 25.21891418563923 24.7935951963973 35 23.2424318238679 26.244683512634477 25.594195646735052 24.91868901676257 36 24.043032274205654 25.719289467100324 25.293970477858394 24.943707780835627 37 23.642732049036777 26.069552164123095 25.243932949712285 25.04378283712785 38 22.611305652826413 26.088044022011005 26.138069034517258 25.162581290645324 39 23.736868434217108 26.96348174087044 24.112056028014006 25.18759379689845 40 24.212106053026513 26.96348174087044 23.88694347173587 24.937468734367183 41 24.7935951963973 24.49337002752064 24.943707780835627 25.769326995246434 42 23.8988988988989 25.725725725725724 25.225225225225223 25.150150150150154 43 25.99449587190393 26.044533400050035 25.494120590442833 22.466850137603203 44 24.44333249937453 25.01876407305479 25.99449587190393 24.54340755566675 45 24.043032274205654 26.244683512634477 25.99449587190393 23.71778834125594 46 24.768576432324245 25.369026770077557 25.544158118588946 24.31823867900926 47 24.924924924924923 24.8998998998999 24.724724724724727 25.45045045045045 48 24.64964964964965 25.55055055055055 24.6996996996997 25.100100100100097 49 24.0 26.650000000000002 24.925 24.425 50 24.55613903475869 25.55638909727432 24.5311327831958 25.35633908477119 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.5 10 2.0 11 1.5 12 1.0 13 1.5 14 2.0 15 3.0 16 4.0 17 3.5 18 3.0 19 2.5 20 2.0 21 3.5 22 5.0 23 7.0 24 9.0 25 13.5 26 18.0 27 16.5 28 15.0 29 20.0 30 25.0 31 51.0 32 77.0 33 91.0 34 105.0 35 124.0 36 143.0 37 161.5 38 180.0 39 203.5 40 227.0 41 268.0 42 309.0 43 314.0 44 319.0 45 325.0 46 331.0 47 329.5 48 328.0 49 331.5 50 335.0 51 319.0 52 303.0 53 265.0 54 227.0 55 226.0 56 225.0 57 193.0 58 161.0 59 141.0 60 121.0 61 94.5 62 68.0 63 67.5 64 67.0 65 63.5 66 60.0 67 54.5 68 49.0 69 56.0 70 63.0 71 71.0 72 79.0 73 75.5 74 72.0 75 49.0 76 26.0 77 20.0 78 14.0 79 14.0 80 14.0 81 9.5 82 5.0 83 3.5 84 2.0 85 2.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10 0.025 11 0.0 12 0.025 13 0.025 14 0.025 15 0.025 16 0.025 17 0.025 18 0.05 19 0.075 20 0.05 21 0.075 22 0.075 23 0.075 24 0.1 25 0.1 26 0.1 27 0.075 28 0.05 29 0.05 30 0.05 31 0.075 32 0.05 33 0.075 34 0.075 35 0.075 36 0.075 37 0.075 38 0.05 39 0.05 40 0.05 41 0.075 42 0.1 43 0.075 44 0.075 45 0.075 46 0.075 47 0.1 48 0.1 49 0.0 50 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 93.44666849465314 85.2 2 4.414587332053743 8.05 3 1.5355086372360844 4.2 4 0.4387167534960241 1.6 5 0.08225939128050452 0.375 6 0.054839594187003016 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027419797093501508 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 14 (97% over 44bp) CTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTT 6 0.15 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAA 6 0.15 No Hit CTCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCG 5 0.125 No Hit CCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTA 5 0.125 No Hit GTCGGGGGCATTCGTATTTCATAGTCAGAGGTGAAATTCTTGGATTTATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10 0.1 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.1 0.0 0.0 0.0 0.0 13 0.1 0.0 0.0 0.0 0.0 14 0.1 0.0 0.0 0.0 0.0 15 0.1 0.0 0.0 0.0 0.0 16 0.1 0.0 0.0 0.0 0.0 17 0.1 0.0 0.0 0.0 0.0 18 0.1 0.0 0.0 0.0 0.0 19 0.1 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241389 spots for SRR3317474.sra Written 2241389 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra Read 2241381 spots for SRR3317474.sra Written 2241381 spots for SRR3317474.sra SRR ids: ['SRR3317474.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__asixvc8 SRR3317474.sra spots: 44827628 blocks: [[1, 2241381], [2241382, 4482762], [4482763, 6724143], [6724144, 8965524], [8965525, 11206905], [11206906, 13448286], [13448287, 15689667], [15689668, 17931048], [17931049, 20172429], [20172430, 22413810], [22413811, 24655191], [24655192, 26896572], [26896573, 29137953], [29137954, 31379334], [31379335, 33620715], [33620716, 35862096], [35862097, 38103477], [38103478, 40344858], [40344859, 42586239], [42586240, 44827628]] SRR3317474 file size 7496390 SRR3317474 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317474 SRR3317474_1.fastq Input file: SRR3317474_1.fastq trimmed: SRR3317474-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:38:54 2025 >> started Tue Feb 11 11:39:11 2025 >> done (16.578s) 44827628 reads processed; of these: 942528 ( 2.10%) short reads filtered out after trimming by size control 1007547 ( 2.25%) empty reads filtered out after trimming by size control 42877553 (95.65%) reads available; of these: 3875074 ( 9.04%) trimmed reads available after processing 39002479 (90.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 48418 0.11% 19 45584 0.11% 20 41429 0.10% 21 41229 0.10% 22 43848 0.10% 23 46500 0.11% 24 50485 0.12% 25 55467 0.13% 26 55154 0.13% 27 54997 0.13% 28 56047 0.13% 29 60864 0.14% 30 67888 0.16% 31 69501 0.16% 32 76769 0.18% 33 70129 0.16% 34 78913 0.18% 35 80823 0.19% 36 88157 0.21% 37 88732 0.21% 38 93383 0.22% 39 100529 0.23% 40 109969 0.26% 41 128612 0.30% 42 145042 0.34% 43 163317 0.38% 44 183391 0.43% 45 215377 0.50% 46 269498 0.63% 47 395224 0.92% 48 379177 0.88% 49 470621 1.10% 50 39002479 90.96% 42877553 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=23 prefix-density=0.48 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=19.56 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=1.1 sequence=GTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTGGGGCTGAATCTCCCGATGGAGAGGATGGTGATGAAGGAGATGAGTACTGATA Started job on | Feb 11 11:39:23 Started mapping on | Feb 11 11:39:23 Finished on | Feb 11 11:40:45 Mapping speed, Million of reads per hour | 1882.43 Number of input reads | 42877553 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 21101305 Uniquely mapped reads % | 49.21% Average mapped length | 49.31 Number of splices: Total | 2404856 Number of splices: Annotated (sjdb) | 2360593 Number of splices: GT/AG | 2369209 Number of splices: GC/AG | 27421 Number of splices: AT/AC | 1936 Number of splices: Non-canonical | 6290 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 1.63 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1277829 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 20210777 % of reads mapped to too many loci | 47.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 20498419 20498419 20498419 N_multimapping 1277829 1277829 1277829 N_noFeature 1550820 11170930 11332174 N_ambiguous 211097 30155 32149 UnstrandedReadsAssigned:19339388 PositiveStrandReadsAssigned:9900220 NegativeStrandReadsAssigned:9736982 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317474 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317474-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,877,553 reads, 35,455,696 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR3317474.ke.tsv 34699 SRR3317474.se.tsv 87100 total ==> SRR3317474.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 604.517 10.8153 Potri.005G024800.1.v4.1 1035 936 27.0022 0.990436 Potri.004G059700.1.v4.1 961 862 29 1.15503 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 336.38 4.06073 Potri.016G087400.1.v4.1 270 171 1288.4 258.676 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 47.6315 0.976881 Potri.012G127500.1.v4.1 977 878 5816 227.422 ==> SRR3317474.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3307 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 301 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR3317474 completed mapping pipeline successfully