Starting /dee2/code/volunteer_pipeline.sh SRR3317476 current disk space = 3051514990592 free memory = 1502193932 SRR3317476 SRAfilesize 0a71cadb4c2ef4606703cb886fd0f0e5 SRR3317476.sra SRR3317476.sra file validated SRR3317476 is single end SRR3317476 is conventional basespace SRR3317476 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317476_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.12525 34.0 31.0 34.0 28.0 34.0 2 31.25725 34.0 31.0 34.0 27.0 34.0 3 31.5515 34.0 31.0 34.0 28.0 34.0 4 34.849 37.0 35.0 37.0 32.0 37.0 5 34.78825 37.0 35.0 37.0 32.0 37.0 6 34.7005 37.0 35.0 37.0 32.0 37.0 7 34.75075 37.0 35.0 37.0 32.0 37.0 8 34.72675 37.0 35.0 37.0 32.0 37.0 9 36.25025 39.0 37.0 39.0 32.0 39.0 10 36.14075 39.0 37.0 39.0 32.0 39.0 11 36.06925 39.0 37.0 39.0 32.0 39.0 12 35.9615 39.0 37.0 39.0 31.0 39.0 13 36.11725 39.0 37.0 39.0 32.0 39.0 14 37.42625 40.0 38.0 41.0 32.0 41.0 15 37.2025 40.0 38.0 41.0 31.0 41.0 16 37.29725 40.0 38.0 41.0 31.0 41.0 17 37.17025 40.0 38.0 41.0 31.0 41.0 18 37.219 40.0 38.0 41.0 31.0 41.0 19 37.28525 40.0 38.0 41.0 31.0 41.0 20 37.042 40.0 38.0 41.0 31.0 41.0 21 36.88875 40.0 38.0 41.0 30.0 41.0 22 36.933 40.0 38.0 41.0 30.0 41.0 23 36.67775 40.0 38.0 41.0 30.0 41.0 24 36.82325 40.0 38.0 41.0 30.0 41.0 25 36.76425 40.0 38.0 41.0 30.0 41.0 26 36.818 40.0 38.0 41.0 30.0 41.0 27 36.70375 40.0 38.0 41.0 30.0 41.0 28 36.53875 40.0 37.0 41.0 30.0 41.0 29 36.3575 40.0 37.0 41.0 27.0 41.0 30 36.356 40.0 37.0 41.0 28.0 41.0 31 36.274 40.0 37.0 41.0 28.0 41.0 32 36.0415 40.0 37.0 41.0 26.0 41.0 33 36.07925 40.0 37.0 41.0 27.0 41.0 34 34.99325 40.0 35.0 41.0 21.0 41.0 35 35.46675 40.0 36.0 41.0 24.0 41.0 36 35.63125 40.0 36.0 41.0 25.0 41.0 37 35.5185 40.0 36.0 41.0 25.0 41.0 38 35.628 40.0 36.0 41.0 25.0 41.0 39 35.55075 40.0 36.0 41.0 26.0 41.0 40 35.136 40.0 35.0 41.0 23.0 41.0 41 35.07725 40.0 35.0 41.0 24.0 41.0 42 35.107 40.0 35.0 41.0 24.0 41.0 43 35.02 40.0 35.0 41.0 23.0 41.0 44 34.919 40.0 35.0 41.0 23.0 41.0 45 34.745 40.0 35.0 41.0 22.0 41.0 46 34.58975 39.0 35.0 41.0 20.0 41.0 47 34.18675 39.0 34.0 41.0 15.0 41.0 48 34.08375 39.0 34.0 41.0 15.0 41.0 49 33.58475 39.0 34.0 41.0 2.0 41.0 50 32.59075 38.0 32.0 40.0 2.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 94.0 3 4.0 4 11.0 5 9.0 6 10.0 7 11.0 8 7.0 9 4.0 10 6.0 11 8.0 12 11.0 13 7.0 14 10.0 15 6.0 16 9.0 17 10.0 18 11.0 19 6.0 20 14.0 21 12.0 22 30.0 23 17.0 24 21.0 25 31.0 26 24.0 27 26.0 28 30.0 29 37.0 30 45.0 31 65.0 32 73.0 33 104.0 34 114.0 35 147.0 36 235.0 37 358.0 38 629.0 39 1754.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.56229383405227 14.894696777467647 8.449632073077899 52.09337731540218 2 20.25 19.15 36.25 24.349999999999998 3 20.150000000000002 21.3 26.650000000000002 31.900000000000002 4 25.424999999999997 27.175 19.675 27.725 5 27.875 30.7 21.55 19.875 6 22.400000000000002 34.599999999999994 23.375 19.625 7 19.025 22.2 37.475 21.3 8 19.950000000000003 24.625 29.925 25.5 9 23.1615807903952 22.086043021510758 32.741370685342666 22.011005502751377 10 20.710355177588795 35.34267133566784 24.912456228114056 19.034517258629315 11 26.950000000000003 26.674999999999997 21.4 24.975 12 23.680920230057513 22.85571392848212 26.806701675418854 26.65666416604151 13 21.165874405804352 28.34625969477108 28.29622216662497 22.191643732799598 14 21.52152152152152 27.2022022022022 27.25225225225225 24.024024024024023 15 23.261630815407706 27.863931965982992 26.3631815907954 22.511255627813906 16 23.167375531648737 25.619214410808105 26.26970227670753 24.943707780835627 17 24.61230615307654 26.8384192096048 26.588294147073537 21.96098049024512 18 23.1981981981982 27.05205205205205 27.352352352352355 22.3973973973974 19 23.271543086172343 28.0561122244489 25.576152304609217 23.09619238476954 20 23.404255319148938 27.25907384230288 27.334167709637047 22.002503128911137 21 25.169215342191027 25.670594133868136 27.224868388067186 21.93532213587365 22 23.678276121272866 28.514156852919072 24.480080180405913 23.327486845402152 23 23.684210526315788 28.32080200501253 24.786967418546364 23.208020050125313 24 23.84056154424668 28.002005515166704 25.09400852343946 23.063424417147154 25 23.489596390072702 26.999247931812487 26.046628227625973 23.464527450488845 26 24.316871396339934 27.275006267234897 25.495111556781147 22.913010779644022 27 22.93807971922788 26.84883429430935 26.096766106793684 24.116319879669092 28 23.729662077597 27.734668335419272 23.60450563204005 24.93116395494368 29 25.106382978723403 26.5081351689612 25.90738423028786 22.478097622027533 30 23.0980980980981 26.476476476476474 27.127127127127125 23.2982982982983 31 23.672344689378757 25.125250501002007 25.60120240480962 25.60120240480962 32 23.623623623623622 28.128128128128125 25.2002002002002 23.04804804804805 33 22.90152843898772 27.3365071410674 25.256827862691054 24.50513655725382 34 24.035087719298247 26.71679197994987 26.04010025062657 23.208020050125313 35 22.612183504637752 27.901729756831283 25.444973677613437 24.041113060917525 36 24.185463659147867 26.49122807017544 25.914786967418546 23.408521303258144 37 23.816679188580014 25.519659403956922 27.598297019784624 23.065364387678436 38 22.664663160530928 27.923866766841975 25.494615577260205 23.916854495366895 39 23.103879849812266 27.384230287859822 25.682102628285357 23.829787234042556 40 23.94894894894895 27.352352352352355 24.8998998998999 23.7987987987988 41 24.874749498997996 27.029058116232463 25.576152304609217 22.52004008016032 42 23.464527450488845 28.578591125595388 25.04387064427175 22.913010779644022 43 24.93734335839599 26.190476190476193 26.842105263157894 22.030075187969924 44 23.55889724310777 26.36591478696742 26.21553884711779 23.859649122807017 45 23.55889724310777 25.13784461152882 27.869674185463662 23.43358395989975 46 23.489596390072702 26.34745550263224 26.44773126096766 23.7152168463274 47 24.442216094259212 26.52293807971923 25.19428428177488 23.84056154424668 48 23.74874874874875 25.575575575575577 26.75175175175175 23.923923923923923 49 22.35 27.150000000000002 25.624999999999996 24.875 50 22.961480740370185 28.064032016008007 25.53776888444222 23.43671835917959 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 1.5 12 2.0 13 1.0 14 0.0 15 3.0 16 6.0 17 4.0 18 2.0 19 2.5 20 3.0 21 6.0 22 9.0 23 11.5 24 14.0 25 14.5 26 15.0 27 25.5 28 36.0 29 43.5 30 51.0 31 71.5 32 92.0 33 112.5 34 133.0 35 154.5 36 176.0 37 189.5 38 203.0 39 251.5 40 300.0 41 312.5 42 325.0 43 331.5 44 338.0 45 344.0 46 350.0 47 362.0 48 374.0 49 333.0 50 292.0 51 286.0 52 280.0 53 245.0 54 210.0 55 198.0 56 186.0 57 171.5 58 157.0 59 128.5 60 100.0 61 81.5 62 63.0 63 55.0 64 47.0 65 36.5 66 26.0 67 35.5 68 45.0 69 42.5 70 40.0 71 44.0 72 48.0 73 44.5 74 41.0 75 28.5 76 16.0 77 11.0 78 6.0 79 5.5 80 5.0 81 3.5 82 2.0 83 2.5 84 3.0 85 2.5 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10 0.05 11 0.0 12 0.025 13 0.075 14 0.1 15 0.05 16 0.075 17 0.05 18 0.1 19 0.2 20 0.125 21 0.27499999999999997 22 0.22499999999999998 23 0.25 24 0.27499999999999997 25 0.27499999999999997 26 0.27499999999999997 27 0.27499999999999997 28 0.125 29 0.125 30 0.1 31 0.2 32 0.1 33 0.22499999999999998 34 0.25 35 0.27499999999999997 36 0.25 37 0.17500000000000002 38 0.17500000000000002 39 0.125 40 0.1 41 0.2 42 0.27499999999999997 43 0.25 44 0.25 45 0.25 46 0.27499999999999997 47 0.27499999999999997 48 0.1 49 0.0 50 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.95 #Duplication Level Percentage of deduplicated Percentage of total 1 94.9435180204411 88.25 2 3.9806347498655192 7.3999999999999995 3 0.8068854222700376 2.25 4 0.10758472296933834 0.4 5 0.08068854222700376 0.375 6 0.026896180742334585 0.15 7 0.0 0.0 8 0.026896180742334585 0.2 9 0.0 0.0 >10 0.026896180742334585 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 39 0.975 TruSeq Adapter, Index 15 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTA 8 0.2 TruSeq Adapter, Index 15 (97% over 40bp) CTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTT 6 0.15 No Hit CTCCGATTCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCAC 5 0.125 No Hit CCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATA 5 0.125 No Hit CAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGGAATTCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.2 0.0 0.0 0.0 0.0 2 0.2 0.0 0.0 0.0 0.0 3 0.2 0.0 0.0 0.0 0.0 4 0.2 0.0 0.0 0.0 0.0 5 0.2 0.0 0.0 0.0 0.0 6 0.2 0.0 0.0 0.0 0.0 7 0.2 0.0 0.0 0.0 0.0 8 0.2 0.0 0.0 0.0 0.0 9 0.2 0.0 0.0 0.0 0.0 10 0.2 0.0 0.0 0.0 0.0 11 0.2 0.0 0.0 0.0 0.0 12 0.225 0.0 0.0 0.0 0.0 13 0.225 0.0 0.0 0.0 0.0 14 0.225 0.0 0.0 0.0 0.0 15 0.225 0.0 0.0 0.0 0.0 16 0.225 0.0 0.0 0.0 0.0 17 0.225 0.0 0.0 0.0 0.0 18 0.225 0.0 0.0 0.0 0.0 19 0.225 0.0 0.0 0.0 0.0 20 0.225 0.0 0.0 0.0 0.0 21 0.225 0.0 0.0 0.0 0.0 22 0.225 0.0 0.0 0.0 0.0 23 0.225 0.0 0.0 0.0 0.0 24 0.225 0.0 0.0 0.0 0.0 25 0.225 0.0 0.0 0.0 0.0 26 0.225 0.0 0.0 0.0 0.0 27 0.225 0.0 0.0 0.0 0.0 28 0.225 0.0 0.0 0.0 0.0 29 0.225 0.0 0.0 0.0 0.0 30 0.225 0.0 0.0 0.0 0.0 31 0.25 0.0 0.0 0.0 0.0 32 0.25 0.0 0.0 0.0 0.0 33 0.25 0.0 0.0 0.0 0.0 34 0.25 0.0 0.0 0.0 0.0 35 0.25 0.0 0.0 0.0 0.0 36 0.25 0.0 0.0 0.0 0.0 37 0.25 0.0 0.0 0.0 0.0 38 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963243 spots for SRR3317476.sra Written 1963243 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra Read 1963224 spots for SRR3317476.sra Written 1963224 spots for SRR3317476.sra SRR ids: ['SRR3317476.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h7qc9zxg SRR3317476.sra spots: 39264499 blocks: [[1, 1963224], [1963225, 3926448], [3926449, 5889672], [5889673, 7852896], [7852897, 9816120], [9816121, 11779344], [11779345, 13742568], [13742569, 15705792], [15705793, 17669016], [17669017, 19632240], [19632241, 21595464], [21595465, 23558688], [23558689, 25521912], [25521913, 27485136], [27485137, 29448360], [29448361, 31411584], [31411585, 33374808], [33374809, 35338032], [35338033, 37301256], [37301257, 39264499]] SRR3317476 file size 6564760 SRR3317476 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317476 SRR3317476_1.fastq Input file: SRR3317476_1.fastq trimmed: SRR3317476-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:43:50 2025 >> started Tue Feb 11 11:44:07 2025 >> done (17.578s) 39264499 reads processed; of these: 872197 ( 2.22%) short reads filtered out after trimming by size control 1451939 ( 3.70%) empty reads filtered out after trimming by size control 36940363 (94.08%) reads available; of these: 3116066 ( 8.44%) trimmed reads available after processing 33824297 (91.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 39807 0.11% 19 36891 0.10% 20 34445 0.09% 21 33695 0.09% 22 35853 0.10% 23 38219 0.10% 24 41721 0.11% 25 44386 0.12% 26 45340 0.12% 27 44592 0.12% 28 45559 0.12% 29 48023 0.13% 30 53278 0.14% 31 53332 0.14% 32 58320 0.16% 33 54865 0.15% 34 61729 0.17% 35 63616 0.17% 36 67982 0.18% 37 70593 0.19% 38 73876 0.20% 39 80249 0.22% 40 88153 0.24% 41 102211 0.28% 42 115558 0.31% 43 129132 0.35% 44 147400 0.40% 45 173974 0.47% 46 217761 0.59% 47 327120 0.89% 48 304985 0.83% 49 383401 1.04% 50 33824297 91.56% 36940363 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=22 prefix-density=0.36 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=62.78 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.9 sequence=AAGAAGAAGAAG Started job on | Feb 11 11:44:19 Started mapping on | Feb 11 11:44:19 Finished on | Feb 11 11:45:16 Mapping speed, Million of reads per hour | 2333.08 Number of input reads | 36940363 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 21949204 Uniquely mapped reads % | 59.42% Average mapped length | 49.28 Number of splices: Total | 2536182 Number of splices: Annotated (sjdb) | 2487348 Number of splices: GT/AG | 2493272 Number of splices: GC/AG | 33382 Number of splices: AT/AC | 2422 Number of splices: Non-canonical | 7106 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.02% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1487357 % of reads mapped to multiple loci | 4.03% Number of reads mapped to too many loci | 13146538 % of reads mapped to too many loci | 35.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.96% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 13503802 13503802 13503802 N_multimapping 1487357 1487357 1487357 N_noFeature 1497627 11603238 11744953 N_ambiguous 167416 34176 35038 UnstrandedReadsAssigned:20284161 PositiveStrandReadsAssigned:10311790 NegativeStrandReadsAssigned:10169213 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317476 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317476-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,940,363 reads, 30,627,592 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52401 SRR3317476.ke.tsv 34699 SRR3317476.se.tsv 87100 total ==> SRR3317476.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1273 24.4583 Potri.005G024800.1.v4.1 1035 936 1284.12 50.5826 Potri.004G059700.1.v4.1 961 862 64 2.73744 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 690.874 8.95657 Potri.016G087400.1.v4.1 270 171 806.527 173.898 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 11.1709 0.246039 Potri.012G127500.1.v4.1 977 878 43632 1832.24 ==> SRR3317476.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 211 Potri.001G233950.v4.1 8 Potri.001G122700.v4.1 472 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3317476 completed mapping pipeline successfully