Starting /dee2/code/volunteer_pipeline.sh SRR3317480 current disk space = 3052508413952 free memory = 1460379576 SRR3317480 SRAfilesize efc5ca13b922a1e83103cbaf84dec8fb SRR3317480.sra SRR3317480.sra file validated SRR3317480 is single end SRR3317480 is conventional basespace SRR3317480 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.48175 34.0 31.0 34.0 29.0 34.0 2 31.6125 34.0 31.0 34.0 28.0 34.0 3 31.75075 34.0 31.0 34.0 28.0 34.0 4 35.23125 37.0 35.0 37.0 32.0 37.0 5 35.214 37.0 35.0 37.0 32.0 37.0 6 35.1435 37.0 35.0 37.0 32.0 37.0 7 35.22325 37.0 35.0 37.0 33.0 37.0 8 35.20425 37.0 35.0 37.0 33.0 37.0 9 36.7525 39.0 37.0 39.0 33.0 39.0 10 36.71175 39.0 37.0 39.0 33.0 39.0 11 36.70025 39.0 37.0 39.0 33.0 39.0 12 36.49575 39.0 37.0 39.0 32.0 39.0 13 36.61275 39.0 37.0 39.0 33.0 39.0 14 37.9075 40.0 38.0 41.0 33.0 41.0 15 37.7995 40.0 38.0 41.0 33.0 41.0 16 37.89275 40.0 38.0 41.0 33.0 41.0 17 37.8015 40.0 38.0 41.0 33.0 41.0 18 37.807 40.0 38.0 41.0 33.0 41.0 19 37.85875 40.0 39.0 41.0 33.0 41.0 20 37.68525 40.0 38.0 41.0 32.0 41.0 21 37.53925 40.0 38.0 41.0 32.0 41.0 22 37.54125 40.0 38.0 41.0 32.0 41.0 23 37.3865 40.0 38.0 41.0 32.0 41.0 24 37.411 40.0 38.0 41.0 32.0 41.0 25 37.5045 40.0 38.0 41.0 32.0 41.0 26 37.457 40.0 38.0 41.0 32.0 41.0 27 37.381 40.0 38.0 41.0 32.0 41.0 28 37.21925 40.0 38.0 41.0 31.0 41.0 29 37.2345 40.0 38.0 41.0 31.0 41.0 30 37.166 40.0 38.0 41.0 31.0 41.0 31 37.18325 40.0 38.0 41.0 31.0 41.0 32 36.9725 40.0 38.0 41.0 31.0 41.0 33 37.0055 40.0 38.0 41.0 31.0 41.0 34 36.049 40.0 36.0 41.0 27.0 41.0 35 36.4985 40.0 37.0 41.0 30.0 41.0 36 36.7355 40.0 38.0 41.0 30.0 41.0 37 36.7025 40.0 37.0 41.0 30.0 41.0 38 36.75375 40.0 37.0 41.0 30.0 41.0 39 36.665 40.0 37.0 41.0 30.0 41.0 40 36.32575 40.0 37.0 41.0 29.0 41.0 41 36.20875 40.0 37.0 41.0 29.0 41.0 42 36.237 40.0 37.0 41.0 30.0 41.0 43 36.24125 40.0 37.0 41.0 30.0 41.0 44 36.14625 40.0 37.0 41.0 28.0 41.0 45 36.085 40.0 37.0 41.0 30.0 41.0 46 35.9825 40.0 37.0 41.0 29.0 41.0 47 35.4555 40.0 36.0 41.0 26.0 41.0 48 35.435 40.0 36.0 41.0 26.0 41.0 49 35.087 39.0 35.0 41.0 26.0 41.0 50 34.112 38.0 34.0 40.0 20.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 57.0 3 3.0 4 11.0 5 6.0 6 6.0 7 7.0 8 9.0 9 9.0 10 2.0 11 4.0 12 11.0 13 5.0 14 4.0 15 9.0 16 8.0 17 2.0 18 4.0 19 8.0 20 3.0 21 9.0 22 9.0 23 15.0 24 18.0 25 18.0 26 29.0 27 31.0 28 25.0 29 49.0 30 45.0 31 56.0 32 63.0 33 79.0 34 117.0 35 143.0 36 220.0 37 350.0 38 670.0 39 1886.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.539161192521476 15.285497726124305 11.445174330469934 45.73016675088428 2 21.65 22.400000000000002 32.475 23.474999999999998 3 20.1 23.400000000000002 27.825 28.675 4 24.224999999999998 27.075 21.375 27.325 5 25.174999999999997 31.6 22.325 20.9 6 22.3 35.625 22.7 19.375 7 18.35 23.125 40.775 17.75 8 19.375 26.0 30.075000000000003 24.55 9 21.575 23.65 31.75 23.025000000000002 10 19.45 38.475 24.85 17.224999999999998 11 24.575 30.599999999999998 21.975 22.85 12 20.5 25.55 29.075 24.875 13 20.150000000000002 29.15 28.825 21.875 14 21.010505252626313 28.01400700350175 27.613806903451728 23.36168084042021 15 21.475 28.475 26.6 23.45 16 20.150000000000002 28.1 28.025 23.724999999999998 17 23.25 28.000000000000004 25.650000000000002 23.1 18 21.19089316987741 27.820865649236925 27.920940705529144 23.067300475356518 19 22.441831373530146 28.49637227920941 27.045283962972228 22.016512384288216 20 21.19089316987741 27.420565424068048 29.72229171878909 21.66624968726545 21 22.9672254190643 28.021015761821367 27.570678008506377 21.441080810607957 22 21.290968226169625 29.82236677508131 27.87090317738304 21.015761821366024 23 21.61621215911934 30.222667000250187 25.8443832874656 22.316737553164874 24 21.30162703379224 26.783479349186486 28.510638297872344 23.404255319148938 25 20.690517888416313 27.920940705529144 28.57142857142857 22.81711283462597 26 20.665499124343256 28.921691268451337 26.144608456342254 24.26820115086315 27 20.090067550662997 28.446334751063297 27.195396547410557 24.26820115086315 28 20.715536652489366 30.748061045784336 27.020265198899175 21.51613710282712 29 23.592694520890667 28.521391043282463 26.670002501876404 21.215911933950462 30 20.440330247685765 27.970978233675257 28.04603452589442 23.54265699274456 31 21.09081811358519 28.57142857142857 28.29622216662497 22.041531148361273 32 21.56617463097323 29.67225419064298 27.445584188141105 21.31598699024268 33 21.46609957468101 27.745809357017766 27.52064048036027 23.267450587940957 34 21.866399799849887 26.945208906680012 27.495621716287218 23.692769577182887 35 21.61621215911934 28.42131598699024 26.619964973730298 23.34250688016012 36 23.892919689767325 27.745809357017766 26.99524643482612 21.36602451838879 37 21.916437327995997 27.1703777833375 28.32124093069802 22.59194395796848 38 19.564673505128845 29.271953965474108 28.021015761821367 23.14235676757568 39 21.46609957468101 27.595696772579437 27.1703777833375 23.767825869402053 40 22.34175631723793 27.47060295221416 25.99449587190393 24.193144858643983 41 22.516887665749312 29.72229171878909 26.26970227670753 21.491118338754063 42 21.51613710282712 29.071803852889666 28.221165874405806 21.19089316987741 43 20.165123842882164 29.171878909181885 28.521391043282463 22.141606204653492 44 21.115836877658246 27.77082812109082 28.04603452589442 23.067300475356518 45 21.09081811358519 28.246184638478862 28.621466099574683 22.041531148361273 46 22.066549912434326 27.820865649236925 26.419814861145856 23.692769577182887 47 23.71778834125594 28.57142857142857 26.09457092819615 21.61621215911934 48 21.72172172172172 27.52752752752753 29.004004004004003 21.746746746746748 49 20.625 28.825 27.200000000000003 23.35 50 20.375 28.1 29.049999999999997 22.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 2.0 14 3.0 15 4.0 16 5.0 17 5.0 18 5.0 19 4.5 20 4.0 21 6.5 22 9.0 23 15.0 24 21.0 25 29.0 26 37.0 27 39.5 28 42.0 29 57.0 30 72.0 31 93.0 32 114.0 33 145.0 34 176.0 35 194.5 36 213.0 37 253.0 38 293.0 39 312.5 40 332.0 41 355.5 42 379.0 43 391.0 44 403.0 45 386.5 46 370.0 47 369.5 48 369.0 49 323.0 50 277.0 51 257.5 52 238.0 53 211.5 54 185.0 55 184.5 56 184.0 57 137.0 58 90.0 59 63.5 60 37.0 61 44.5 62 52.0 63 35.0 64 18.0 65 18.5 66 19.0 67 13.0 68 7.0 69 11.5 70 16.0 71 13.5 72 11.0 73 11.0 74 11.0 75 6.5 76 2.0 77 2.5 78 3.0 79 2.0 80 1.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.05 15 0.0 16 0.0 17 0.0 18 0.075 19 0.075 20 0.075 21 0.075 22 0.075 23 0.075 24 0.125 25 0.075 26 0.075 27 0.075 28 0.075 29 0.075 30 0.075 31 0.075 32 0.075 33 0.075 34 0.075 35 0.075 36 0.075 37 0.075 38 0.075 39 0.075 40 0.075 41 0.075 42 0.075 43 0.075 44 0.075 45 0.075 46 0.075 47 0.075 48 0.1 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46483180428135 97.575 2 0.4332313965341488 0.8500000000000001 3 0.05096839959225281 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05096839959225281 1.425 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTAT 46 1.15 TruSeq Adapter, Index 16 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTA 11 0.27499999999999997 TruSeq Adapter, Index 16 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.325 0.0 0.0 0.0 0.0 2 0.325 0.0 0.0 0.0 0.0 3 0.325 0.0 0.0 0.0 0.0 4 0.325 0.0 0.0 0.0 0.0 5 0.325 0.0 0.0 0.0 0.0 6 0.325 0.0 0.0 0.0 0.0 7 0.325 0.0 0.0 0.0 0.0 8 0.325 0.0 0.0 0.0 0.0 9 0.325 0.0 0.0 0.0 0.0 10 0.325 0.0 0.0 0.0 0.0 11 0.325 0.0 0.0 0.0 0.0 12 0.325 0.0 0.0 0.0 0.0 13 0.35 0.0 0.0 0.0 0.0 14 0.35 0.0 0.0 0.0 0.0 15 0.35 0.0 0.0 0.0 0.0 16 0.35 0.0 0.0 0.0 0.0 17 0.35 0.0 0.0 0.0 0.0 18 0.35 0.0 0.0 0.0 0.0 19 0.35 0.0 0.0 0.0 0.0 20 0.35 0.0 0.0 0.0 0.0 21 0.425 0.0 0.0 0.0 0.0 22 0.425 0.0 0.0 0.0 0.0 23 0.425 0.0 0.0 0.0 0.0 24 0.425 0.0 0.0 0.0 0.0 25 0.425 0.0 0.0 0.0 0.0 26 0.425 0.0 0.0 0.0 0.0 27 0.425 0.0 0.0 0.0 0.0 28 0.425 0.0 0.0 0.0 0.0 29 0.425 0.0 0.0 0.0 0.0 30 0.425 0.0 0.0 0.0 0.0 31 0.425 0.0 0.0 0.0 0.0 32 0.425 0.0 0.0 0.0 0.0 33 0.425 0.0 0.0 0.0 0.0 34 0.425 0.0 0.0 0.0 0.0 35 0.425 0.0 0.0 0.0 0.0 36 0.425 0.0 0.0 0.0 0.0 37 0.425 0.0 0.0 0.0 0.0 38 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923640 spots for SRR3317480.sra Written 1923640 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra Read 1923628 spots for SRR3317480.sra Written 1923628 spots for SRR3317480.sra SRR ids: ['SRR3317480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q6ys5k4b SRR3317480.sra spots: 38472572 blocks: [[1, 1923628], [1923629, 3847256], [3847257, 5770884], [5770885, 7694512], [7694513, 9618140], [9618141, 11541768], [11541769, 13465396], [13465397, 15389024], [15389025, 17312652], [17312653, 19236280], [19236281, 21159908], [21159909, 23083536], [23083537, 25007164], [25007165, 26930792], [26930793, 28854420], [28854421, 30778048], [30778049, 32701676], [32701677, 34625304], [34625305, 36548932], [36548933, 38472572]] SRR3317480 file size 6432125 SRR3317480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317480 SRR3317480_1.fastq Input file: SRR3317480_1.fastq trimmed: SRR3317480-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:04:27 2025 >> started Tue Feb 11 11:04:44 2025 >> done (17.297s) 38472572 reads processed; of these: 673662 ( 1.75%) short reads filtered out after trimming by size control 1533281 ( 3.99%) empty reads filtered out after trimming by size control 36265629 (94.26%) reads available; of these: 2470890 ( 6.81%) trimmed reads available after processing 33794739 (93.19%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 29993 0.08% 19 29986 0.08% 20 26143 0.07% 21 25827 0.07% 22 26193 0.07% 23 27673 0.08% 24 28281 0.08% 25 29502 0.08% 26 31154 0.09% 27 31436 0.09% 28 31197 0.09% 29 32180 0.09% 30 34629 0.10% 31 35738 0.10% 32 38830 0.11% 33 38952 0.11% 34 42716 0.12% 35 45160 0.12% 36 48043 0.13% 37 52289 0.14% 38 55617 0.15% 39 60620 0.17% 40 68191 0.19% 41 76636 0.21% 42 85668 0.24% 43 97653 0.27% 44 117170 0.32% 45 141131 0.39% 46 180623 0.50% 47 282151 0.78% 48 269585 0.74% 49 349923 0.96% 50 33794739 93.19% 36265629 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=20 prefix-density=0.06 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=33.04 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.1 sequence=AGAAAGAAAGAA Started job on | Feb 11 11:04:59 Started mapping on | Feb 11 11:04:59 Finished on | Feb 11 11:05:36 Mapping speed, Million of reads per hour | 3528.55 Number of input reads | 36265629 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 31646216 Uniquely mapped reads % | 87.26% Average mapped length | 49.28 Number of splices: Total | 3401899 Number of splices: Annotated (sjdb) | 3341061 Number of splices: GT/AG | 3350567 Number of splices: GC/AG | 39314 Number of splices: AT/AC | 2945 Number of splices: Non-canonical | 9073 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1623714 % of reads mapped to multiple loci | 4.48% Number of reads mapped to too many loci | 2578874 % of reads mapped to too many loci | 7.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.14% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2995699 2995699 2995699 N_multimapping 1623714 1623714 1623714 N_noFeature 1653930 16390957 16720178 N_ambiguous 279513 43878 47013 UnstrandedReadsAssigned:29712773 PositiveStrandReadsAssigned:15211381 NegativeStrandReadsAssigned:14879025 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317480 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317480-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,265,629 reads, 30,885,488 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52401 SRR3317480.ke.tsv 34699 SRR3317480.se.tsv 87100 total ==> SRR3317480.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 823.535 17.0835 Potri.005G024800.1.v4.1 1035 936 125 5.31622 Potri.004G059700.1.v4.1 961 862 49 2.26286 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 369.504 5.172 Potri.016G087400.1.v4.1 270 171 1406.46 327.415 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 106.363 2.52932 Potri.012G127500.1.v4.1 977 878 11287 511.744 ==> SRR3317480.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2848 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 574 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3317480 completed mapping pipeline successfully