Starting /dee2/code/volunteer_pipeline.sh SRR3317482 current disk space = 3051663626240 free memory = 1412468760 SRR3317482 SRAfilesize 89c1becb25fc4b1cc268c6ef8c47d63c SRR3317482.sra SRR3317482.sra file validated SRR3317482 is single end SRR3317482 is conventional basespace SRR3317482 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317482_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4205 34.0 31.0 34.0 28.0 34.0 2 31.555 34.0 31.0 34.0 27.0 34.0 3 31.691 34.0 31.0 34.0 28.0 34.0 4 35.08825 37.0 35.0 37.0 32.0 37.0 5 35.0425 37.0 35.0 37.0 32.0 37.0 6 35.05525 37.0 35.0 37.0 32.0 37.0 7 35.0145 37.0 35.0 37.0 32.0 37.0 8 35.0635 37.0 35.0 37.0 32.0 37.0 9 36.637 39.0 37.0 39.0 33.0 39.0 10 36.52725 39.0 37.0 39.0 33.0 39.0 11 36.477 39.0 37.0 39.0 33.0 39.0 12 36.23825 39.0 37.0 39.0 32.0 39.0 13 36.33 39.0 37.0 39.0 32.0 39.0 14 37.71475 40.0 38.0 41.0 32.0 41.0 15 37.5815 40.0 38.0 41.0 32.0 41.0 16 37.637 40.0 38.0 41.0 32.0 41.0 17 37.44675 40.0 38.0 41.0 32.0 41.0 18 37.516 40.0 38.0 41.0 32.0 41.0 19 37.5845 40.0 38.0 41.0 32.0 41.0 20 37.468 40.0 38.0 41.0 32.0 41.0 21 37.40125 40.0 38.0 41.0 32.0 41.0 22 37.274 40.0 38.0 41.0 32.0 41.0 23 37.0625 40.0 38.0 41.0 31.0 41.0 24 37.06325 40.0 38.0 41.0 31.0 41.0 25 37.23975 40.0 38.0 41.0 31.0 41.0 26 37.20475 40.0 38.0 41.0 31.0 41.0 27 37.0215 40.0 38.0 41.0 31.0 41.0 28 36.84925 40.0 38.0 41.0 30.0 41.0 29 36.74725 40.0 38.0 41.0 30.0 41.0 30 36.69975 40.0 37.0 41.0 30.0 41.0 31 36.5955 40.0 37.0 41.0 30.0 41.0 32 36.45775 40.0 37.0 41.0 29.0 41.0 33 36.50325 40.0 37.0 41.0 30.0 41.0 34 35.46275 40.0 35.0 41.0 25.0 41.0 35 35.69625 40.0 36.0 41.0 25.0 41.0 36 35.8815 40.0 36.0 41.0 26.0 41.0 37 35.7455 40.0 36.0 41.0 25.0 41.0 38 35.90775 40.0 36.0 41.0 27.0 41.0 39 35.89125 40.0 36.0 41.0 27.0 41.0 40 35.54175 40.0 35.0 41.0 27.0 41.0 41 35.42475 40.0 35.0 41.0 25.0 41.0 42 35.4895 40.0 35.0 41.0 26.0 41.0 43 35.37125 40.0 35.0 41.0 25.0 41.0 44 35.41625 40.0 35.0 41.0 26.0 41.0 45 35.2005 40.0 35.0 41.0 25.0 41.0 46 35.0095 40.0 35.0 41.0 23.0 41.0 47 34.4545 39.0 35.0 41.0 20.0 41.0 48 34.2875 39.0 34.0 41.0 20.0 41.0 49 34.13625 39.0 34.0 41.0 15.0 41.0 50 32.99525 38.0 33.0 40.0 2.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 67.0 3 4.0 4 7.0 5 13.0 6 13.0 7 9.0 8 5.0 9 9.0 10 9.0 11 4.0 12 2.0 13 3.0 14 10.0 15 7.0 16 10.0 17 13.0 18 5.0 19 9.0 20 9.0 21 12.0 22 15.0 23 18.0 24 17.0 25 29.0 26 32.0 27 21.0 28 38.0 29 35.0 30 63.0 31 49.0 32 81.0 33 96.0 34 123.0 35 161.0 36 236.0 37 367.0 38 616.0 39 1783.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.692307692307693 16.14123581336696 12.257250945775535 43.909205548549814 2 23.45 20.5 31.324999999999996 24.725 3 21.8 21.65 26.224999999999998 30.325000000000003 4 26.525 26.200000000000003 19.900000000000002 27.375 5 27.975 29.925 21.349999999999998 20.75 6 23.875 35.0 21.4 19.725 7 20.875 22.425 37.75 18.95 8 20.95 26.400000000000002 28.475 24.175 9 23.7 22.125 30.225 23.95 10 20.525 35.875 24.6 19.0 11 26.674999999999997 28.599999999999998 20.7 24.025 12 23.925 24.075 25.424999999999997 26.575 13 22.486243121560783 28.38919459729865 26.863431715857928 22.26113056528264 14 22.81711283462597 28.246184638478862 25.94445834375782 22.992244183137352 15 23.175 27.900000000000002 25.825 23.1 16 21.96098049024512 27.138569284642323 26.038019009504755 24.862431215607803 17 25.974999999999998 24.975 25.525 23.525 18 23.642732049036777 25.769326995246434 27.695771828871653 22.892169126845133 19 22.62262262262262 25.525525525525527 27.677677677677675 24.174174174174173 20 21.97197197197197 26.5015015015015 28.403403403403406 23.123123123123122 21 24.124124124124123 26.101101101101097 26.226226226226224 23.54854854854855 22 23.3983983983984 27.427427427427425 26.151151151151154 23.023023023023022 23 23.0980980980981 29.354354354354356 24.84984984984985 22.6976976976977 24 22.8092138207311 26.339509263895845 25.037556334501755 25.81372058087131 25 23.123123123123122 25.925925925925924 27.37737737737738 23.573573573573572 26 23.685528292438658 25.6885327991988 26.489734601902853 24.13620430645969 27 22.997997997998 26.526526526526528 25.575575575575577 24.8998998998999 28 23.14814814814815 27.927927927927925 25.425425425425423 23.4984984984985 29 24.874874874874877 26.476476476476474 26.276276276276278 22.372372372372375 30 23.14235676757568 25.41906429822367 27.845884413309985 23.592694520890667 31 22.12212212212212 25.525525525525527 27.077077077077078 25.275275275275277 32 23.367525644233176 28.14610958218664 24.86865148861646 23.617713284963724 33 22.52252252252252 27.45245245245245 24.774774774774773 25.25025025025025 34 24.174174174174173 26.176176176176174 26.05105105105105 23.5985985985986 35 24.474474474474476 25.625625625625624 26.026026026026027 23.873873873873876 36 21.996996996996998 26.576576576576578 25.55055055055055 25.875875875875877 37 23.94894894894895 25.075075075075077 25.375375375375377 25.600600600600597 38 24.5995995995996 27.152152152152155 25.575575575575577 22.67267267267267 39 23.723723723723726 24.724724724724727 26.351351351351347 25.2002002002002 40 23.567675756817614 27.645734300725543 24.193144858643983 24.59344508381286 41 24.5995995995996 26.476476476476474 25.525525525525527 23.3983983983984 42 23.404255319148938 26.858573216520647 25.682102628285357 24.055068836045056 43 23.623623623623622 26.601601601601605 27.37737737737738 22.3973973973974 44 23.523523523523522 26.026026026026027 26.05105105105105 24.3993993993994 45 22.62262262262262 26.176176176176174 27.852852852852855 23.34834834834835 46 22.62262262262262 26.026026026026027 27.627627627627625 23.723723723723726 47 25.212819228843266 26.189283925888834 25.338007010515774 23.25988983475213 48 23.492619464598448 25.769326995246434 26.720040030022517 24.0180135101326 49 22.375 28.025 25.45 24.15 50 23.25 27.725 25.724999999999998 23.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.5 16 2.0 17 1.0 18 0.0 19 1.5 20 3.0 21 5.5 22 8.0 23 7.0 24 6.0 25 9.0 26 12.0 27 21.5 28 31.0 29 39.5 30 48.0 31 60.5 32 73.0 33 99.5 34 126.0 35 148.0 36 170.0 37 184.5 38 199.0 39 240.5 40 282.0 41 316.0 42 350.0 43 359.5 44 369.0 45 360.5 46 352.0 47 340.5 48 329.0 49 325.0 50 321.0 51 302.5 52 284.0 53 286.5 54 289.0 55 244.5 56 200.0 57 158.0 58 116.0 59 98.0 60 80.0 61 74.0 62 68.0 63 55.0 64 42.0 65 41.0 66 40.0 67 42.5 68 45.0 69 40.5 70 36.0 71 37.0 72 38.0 73 41.0 74 44.0 75 26.5 76 9.0 77 12.0 78 15.0 79 10.0 80 5.0 81 4.0 82 3.0 83 2.5 84 2.0 85 1.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.05 14 0.075 15 0.0 16 0.05 17 0.0 18 0.075 19 0.1 20 0.1 21 0.1 22 0.1 23 0.1 24 0.15 25 0.1 26 0.15 27 0.1 28 0.1 29 0.1 30 0.075 31 0.1 32 0.075 33 0.1 34 0.1 35 0.1 36 0.1 37 0.1 38 0.1 39 0.1 40 0.075 41 0.1 42 0.125 43 0.1 44 0.1 45 0.1 46 0.1 47 0.15 48 0.075 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.575 #Duplication Level Percentage of deduplicated Percentage of total 1 97.43656814020403 93.125 2 2.2495422443107507 4.3 3 0.209259743656814 0.6 4 0.02615746795710175 0.1 5 0.02615746795710175 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02615746795710175 0.35000000000000003 >50 0.02615746795710175 1.4000000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 56 1.4000000000000001 TruSeq Adapter, Index 18 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTA 14 0.35000000000000003 TruSeq Adapter, Index 18 (97% over 40bp) GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.475 0.0 0.0 0.0 0.0 2 0.475 0.0 0.0 0.0 0.0 3 0.475 0.0 0.0 0.0 0.0 4 0.475 0.0 0.0 0.0 0.0 5 0.475 0.0 0.0 0.0 0.0 6 0.475 0.0 0.0 0.0 0.0 7 0.475 0.0 0.0 0.0 0.0 8 0.475 0.0 0.0 0.0 0.0 9 0.475 0.0 0.0 0.0 0.0 10 0.475 0.0 0.0 0.0 0.0 11 0.475 0.0 0.0 0.0 0.0 12 0.475 0.0 0.0 0.0 0.0 13 0.475 0.0 0.0 0.0 0.0 14 0.475 0.0 0.0 0.0 0.0 15 0.475 0.0 0.0 0.0 0.0 16 0.475 0.0 0.0 0.0 0.0 17 0.475 0.0 0.0 0.0 0.0 18 0.475 0.0 0.0 0.0 0.0 19 0.475 0.0 0.0 0.0 0.0 20 0.475 0.0 0.0 0.0 0.0 21 0.475 0.0 0.0 0.0 0.0 22 0.475 0.0 0.0 0.0 0.0 23 0.475 0.0 0.0 0.0 0.0 24 0.475 0.0 0.0 0.0 0.0 25 0.475 0.0 0.0 0.0 0.0 26 0.475 0.0 0.0 0.0 0.0 27 0.475 0.0 0.0 0.0 0.0 28 0.475 0.0 0.0 0.0 0.0 29 0.475 0.0 0.0 0.0 0.0 30 0.475 0.0 0.0 0.0 0.0 31 0.475 0.0 0.0 0.0 0.0 32 0.475 0.0 0.0 0.0 0.0 33 0.475 0.0 0.0 0.0 0.0 34 0.475 0.0 0.0 0.0 0.0 35 0.475 0.0 0.0 0.0 0.0 36 0.475 0.0 0.0 0.0 0.0 37 0.475 0.0 0.0 0.0 0.0 38 0.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737120 spots for SRR3317482.sra Written 1737120 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra Read 1737103 spots for SRR3317482.sra Written 1737103 spots for SRR3317482.sra SRR ids: ['SRR3317482.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z7twxt4g SRR3317482.sra spots: 34742077 blocks: [[1, 1737103], [1737104, 3474206], [3474207, 5211309], [5211310, 6948412], [6948413, 8685515], [8685516, 10422618], [10422619, 12159721], [12159722, 13896824], [13896825, 15633927], [15633928, 17371030], [17371031, 19108133], [19108134, 20845236], [20845237, 22582339], [22582340, 24319442], [24319443, 26056545], [26056546, 27793648], [27793649, 29530751], [29530752, 31267854], [31267855, 33004957], [33004958, 34742077]] SRR3317482 file size 5807369 SRR3317482 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317482 SRR3317482_1.fastq Input file: SRR3317482_1.fastq trimmed: SRR3317482-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:34:17 2025 >> started Tue Feb 11 11:34:34 2025 >> done (16.561s) 34742077 reads processed; of these: 661838 ( 1.91%) short reads filtered out after trimming by size control 1432953 ( 4.12%) empty reads filtered out after trimming by size control 32647286 (93.97%) reads available; of these: 2657613 ( 8.14%) trimmed reads available after processing 29989673 (91.86%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 31699 0.10% 19 29488 0.09% 20 27988 0.09% 21 27615 0.08% 22 28918 0.09% 23 30497 0.09% 24 32659 0.10% 25 34502 0.11% 26 36402 0.11% 27 36106 0.11% 28 36398 0.11% 29 38540 0.12% 30 41821 0.13% 31 43197 0.13% 32 47835 0.15% 33 45690 0.14% 34 50514 0.15% 35 52896 0.16% 36 56678 0.17% 37 59696 0.18% 38 62575 0.19% 39 68173 0.21% 40 75835 0.23% 41 86965 0.27% 42 96575 0.30% 43 109659 0.34% 44 126456 0.39% 45 150946 0.46% 46 189286 0.58% 47 285539 0.87% 48 272024 0.83% 49 344441 1.06% 50 29989673 91.86% 32647286 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=21 prefix-density=0.26 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=45.36 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=7.9 sequence=AAGAAGAAGAAG Started job on | Feb 11 11:34:45 Started mapping on | Feb 11 11:34:45 Finished on | Feb 11 11:35:30 Mapping speed, Million of reads per hour | 2611.78 Number of input reads | 32647286 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 22336251 Uniquely mapped reads % | 68.42% Average mapped length | 49.28 Number of splices: Total | 2838822 Number of splices: Annotated (sjdb) | 2789699 Number of splices: GT/AG | 2793235 Number of splices: GC/AG | 36068 Number of splices: AT/AC | 2262 Number of splices: Non-canonical | 7257 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.02% Deletion average length | 1.68 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1509369 % of reads mapped to multiple loci | 4.62% Number of reads mapped to too many loci | 8455181 % of reads mapped to too many loci | 25.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.05% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8801666 8801666 8801666 N_multimapping 1509369 1509369 1509369 N_noFeature 1687190 11900746 12031503 N_ambiguous 153475 30839 31694 UnstrandedReadsAssigned:20495586 PositiveStrandReadsAssigned:10404666 NegativeStrandReadsAssigned:10273054 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317482 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317482-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,647,286 reads, 27,049,388 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52401 SRR3317482.ke.tsv 34699 SRR3317482.se.tsv 87100 total ==> SRR3317482.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1281 29.4548 Potri.005G024800.1.v4.1 1035 936 183.029 8.6283 Potri.004G059700.1.v4.1 961 862 63 3.22489 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 314.575 4.88063 Potri.016G087400.1.v4.1 270 171 994.694 256.67 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 49.7924 1.31247 Potri.012G127500.1.v4.1 977 878 44266 2224.63 ==> SRR3317482.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 360 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 592 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3317482 completed mapping pipeline successfully