Starting /dee2/code/volunteer_pipeline.sh SRR3317483 current disk space = 3052103110656 free memory = 1409957768 SRR3317483 SRAfilesize 084b58e2ab0192dfafda07223f6d4f5f SRR3317483.sra SRR3317483.sra file validated SRR3317483 is single end SRR3317483 is conventional basespace SRR3317483 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3317483_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47575 34.0 31.0 34.0 28.0 34.0 2 31.5985 34.0 31.0 34.0 28.0 34.0 3 31.84075 34.0 31.0 34.0 28.0 34.0 4 35.29775 37.0 35.0 37.0 33.0 37.0 5 35.2465 37.0 35.0 37.0 33.0 37.0 6 35.15625 37.0 35.0 37.0 32.0 37.0 7 35.23175 37.0 35.0 37.0 33.0 37.0 8 35.19025 37.0 35.0 37.0 33.0 37.0 9 36.8295 39.0 37.0 39.0 33.0 39.0 10 36.787 39.0 37.0 39.0 33.0 39.0 11 36.703 39.0 37.0 39.0 33.0 39.0 12 36.5485 39.0 37.0 39.0 32.0 39.0 13 36.6515 39.0 37.0 39.0 33.0 39.0 14 38.09225 40.0 38.0 41.0 33.0 41.0 15 37.92725 40.0 38.0 41.0 33.0 41.0 16 37.97575 40.0 38.0 41.0 33.0 41.0 17 37.883 40.0 38.0 41.0 33.0 41.0 18 37.94125 40.0 38.0 41.0 33.0 41.0 19 38.099 40.0 39.0 41.0 34.0 41.0 20 37.808 40.0 38.0 41.0 33.0 41.0 21 37.918 40.0 38.0 41.0 33.0 41.0 22 37.799 40.0 38.0 41.0 32.0 41.0 23 37.62525 40.0 38.0 41.0 32.0 41.0 24 37.657 40.0 38.0 41.0 33.0 41.0 25 37.65425 40.0 38.0 41.0 32.0 41.0 26 37.81675 40.0 38.0 41.0 33.0 41.0 27 37.65775 40.0 38.0 41.0 33.0 41.0 28 37.39875 40.0 38.0 41.0 32.0 41.0 29 37.41825 40.0 38.0 41.0 32.0 41.0 30 37.441 40.0 38.0 41.0 32.0 41.0 31 37.41825 40.0 38.0 41.0 32.0 41.0 32 37.30625 40.0 38.0 41.0 31.0 41.0 33 37.33725 40.0 38.0 41.0 32.0 41.0 34 36.3485 40.0 37.0 41.0 29.0 41.0 35 36.7825 40.0 37.0 41.0 30.0 41.0 36 37.01125 40.0 38.0 41.0 30.0 41.0 37 36.877 40.0 38.0 41.0 30.0 41.0 38 36.9325 40.0 38.0 41.0 30.0 41.0 39 36.9365 40.0 38.0 41.0 30.0 41.0 40 36.5705 40.0 37.0 41.0 30.0 41.0 41 36.54975 40.0 37.0 41.0 30.0 41.0 42 36.567 40.0 37.0 41.0 30.0 41.0 43 36.6825 40.0 37.0 41.0 30.0 41.0 44 36.5545 40.0 37.0 41.0 30.0 41.0 45 36.3835 40.0 37.0 41.0 30.0 41.0 46 36.347 40.0 37.0 41.0 29.0 41.0 47 35.9815 40.0 36.0 41.0 28.0 41.0 48 35.8505 40.0 36.0 41.0 28.0 41.0 49 35.5855 40.0 36.0 41.0 27.0 41.0 50 34.4615 38.0 34.0 40.0 24.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 57.0 3 3.0 4 9.0 5 7.0 6 8.0 7 4.0 8 3.0 9 4.0 10 4.0 11 3.0 12 7.0 13 5.0 14 3.0 15 4.0 16 6.0 17 7.0 18 15.0 19 10.0 20 7.0 21 7.0 22 10.0 23 14.0 24 12.0 25 14.0 26 20.0 27 18.0 28 29.0 29 31.0 30 43.0 31 55.0 32 65.0 33 83.0 34 102.0 35 170.0 36 212.0 37 349.0 38 644.0 39 1956.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.830504180390168 14.796047631112238 12.237142133265772 46.13630605523183 2 20.9 20.8 35.875 22.425 3 20.25 23.425 27.825 28.499999999999996 4 24.775 29.049999999999997 20.4 25.775 5 25.55 33.6 22.8 18.05 6 19.55 35.3 24.95 20.200000000000003 7 17.2 22.475 40.300000000000004 20.025000000000002 8 18.825 25.124999999999996 30.15 25.900000000000002 9 19.975 23.150000000000002 33.225 23.65 10 19.3 36.275 26.900000000000002 17.525 11 24.825 29.575000000000003 22.2 23.400000000000002 12 21.4 24.95 27.05 26.6 13 19.55 28.575 29.65 22.225 14 20.674999999999997 27.400000000000002 29.45 22.475 15 20.599999999999998 26.724999999999998 27.775 24.9 16 20.599999999999998 27.575 28.425 23.400000000000002 17 22.925 27.375 26.75 22.95 18 22.725 26.174999999999997 26.974999999999998 24.125 19 22.325 29.025000000000002 26.724999999999998 21.925 20 22.15 27.925 27.025 22.900000000000002 21 21.975 29.45 26.775 21.8 22 22.0 28.050000000000004 26.55 23.400000000000002 23 22.175 28.549999999999997 26.0 23.275000000000002 24 20.955238809702426 27.53188297074269 27.45686421605401 24.056014003500874 25 22.080520130032507 27.631907976994246 28.457114278569644 21.8304576144036 26 22.405601400350086 27.831957989497376 27.45686421605401 22.305576394098527 27 22.775000000000002 27.55 27.55 22.125 28 21.025 29.425 26.674999999999997 22.875 29 22.425 28.425 27.125 22.025 30 22.875 27.6 27.175 22.35 31 20.974999999999998 27.750000000000004 28.725 22.55 32 22.075 28.799999999999997 27.6 21.525 33 21.425 28.175 27.224999999999998 23.175 34 22.525000000000002 27.55 27.0 22.925 35 22.20555138784696 27.7569392348087 27.731932983245812 22.305576394098527 36 21.7 28.825 26.55 22.925 37 22.6 28.449999999999996 27.075 21.875 38 21.325 28.725 26.200000000000003 23.75 39 22.075 27.775 26.825 23.325000000000003 40 22.7 28.9 25.8 22.6 41 22.875 28.9 26.75 21.475 42 21.85546386596649 28.232058014503625 27.781945486371594 22.13053263315829 43 22.7 28.599999999999998 26.0 22.7 44 20.825 28.7 28.549999999999997 21.925 45 21.0 28.375 27.400000000000002 23.225 46 22.3 27.075 27.925 22.7 47 22.680670167541887 26.70667666916729 27.00675168792198 23.605901475368842 48 20.611835506519558 27.90872617853561 28.761283851554666 22.71815446339017 49 23.7 27.0 26.700000000000003 22.6 50 21.7 27.55 27.0 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 2.0 18 3.0 19 4.5 20 6.0 21 5.0 22 4.0 23 12.0 24 20.0 25 20.0 26 20.0 27 36.5 28 53.0 29 54.5 30 56.0 31 73.0 32 90.0 33 119.0 34 148.0 35 177.0 36 206.0 37 238.5 38 271.0 39 306.5 40 342.0 41 367.0 42 392.0 43 409.0 44 426.0 45 414.5 46 403.0 47 386.0 48 369.0 49 356.0 50 343.0 51 297.5 52 252.0 53 224.5 54 197.0 55 164.0 56 131.0 57 103.0 58 75.0 59 65.0 60 55.0 61 47.5 62 40.0 63 29.5 64 19.0 65 18.0 66 17.0 67 15.0 68 13.0 69 14.0 70 15.0 71 14.0 72 13.0 73 9.5 74 6.0 75 4.5 76 3.0 77 4.5 78 6.0 79 3.0 80 0.0 81 1.0 82 2.0 83 1.0 84 0.0 85 1.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.025 25 0.025 26 0.025 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.025 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.025 43 0.0 44 0.0 45 0.0 46 0.0 47 0.025 48 0.3 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.698568198945 99.225 2 0.27631248430042704 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025119316754584273 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 19 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10 0.1 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.1 0.0 0.0 0.0 0.0 13 0.1 0.0 0.0 0.0 0.0 14 0.1 0.0 0.0 0.0 0.0 15 0.15 0.0 0.0 0.0 0.0 16 0.15 0.0 0.0 0.0 0.0 17 0.175 0.0 0.0 0.0 0.0 18 0.175 0.0 0.0 0.0 0.0 19 0.175 0.0 0.0 0.0 0.0 20 0.175 0.0 0.0 0.0 0.0 21 0.175 0.0 0.0 0.0 0.0 22 0.175 0.0 0.0 0.0 0.0 23 0.175 0.0 0.0 0.0 0.0 24 0.175 0.0 0.0 0.0 0.0 25 0.175 0.0 0.0 0.0 0.0 26 0.175 0.0 0.0 0.0 0.0 27 0.2 0.0 0.0 0.0 0.0 28 0.2 0.0 0.0 0.0 0.0 29 0.2 0.0 0.0 0.0 0.0 30 0.2 0.0 0.0 0.0 0.0 31 0.2 0.0 0.0 0.0 0.0 32 0.225 0.0 0.0 0.0 0.0 33 0.225 0.0 0.0 0.0 0.0 34 0.225 0.0 0.0 0.0 0.0 35 0.225 0.0 0.0 0.0 0.0 36 0.225 0.0 0.0 0.0 0.0 37 0.225 0.0 0.0 0.0 0.0 38 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra Read 1958857 spots for SRR3317483.sra Written 1958857 spots for SRR3317483.sra SRR ids: ['SRR3317483.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2pihc3fk SRR3317483.sra spots: 39177140 blocks: [[1, 1958857], [1958858, 3917714], [3917715, 5876571], [5876572, 7835428], [7835429, 9794285], [9794286, 11753142], [11753143, 13711999], [13712000, 15670856], [15670857, 17629713], [17629714, 19588570], [19588571, 21547427], [21547428, 23506284], [23506285, 25465141], [25465142, 27423998], [27423999, 29382855], [29382856, 31341712], [31341713, 33300569], [33300570, 35259426], [35259427, 37218283], [37218284, 39177140]] SRR3317483 file size 6550115 SRR3317483 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3317483 SRR3317483_1.fastq Input file: SRR3317483_1.fastq trimmed: SRR3317483-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:16:58 2025 >> started Tue Feb 11 11:17:15 2025 >> done (17.033s) 39177140 reads processed; of these: 697832 ( 1.78%) short reads filtered out after trimming by size control 806922 ( 2.06%) empty reads filtered out after trimming by size control 37672386 (96.16%) reads available; of these: 2456594 ( 6.52%) trimmed reads available after processing 35215792 (93.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 29995 0.08% 19 27339 0.07% 20 25250 0.07% 21 24698 0.07% 22 24909 0.07% 23 26276 0.07% 24 27525 0.07% 25 28529 0.08% 26 31289 0.08% 27 30502 0.08% 28 30623 0.08% 29 31442 0.08% 30 33293 0.09% 31 34529 0.09% 32 37419 0.10% 33 38123 0.10% 34 41480 0.11% 35 43740 0.12% 36 46710 0.12% 37 50584 0.13% 38 54939 0.15% 39 59224 0.16% 40 66734 0.18% 41 76471 0.20% 42 84417 0.22% 43 96770 0.26% 44 115762 0.31% 45 141318 0.38% 46 181305 0.48% 47 289714 0.77% 48 269793 0.72% 49 355892 0.94% 50 35215792 93.48% 37672386 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=38.25 fanout-score-rank=2 prefix-density=0.23 prefix-fanout=12.1 sequence=CTTCTTCTTCCTTTGGGGCTTCGACTGCAACCTCCGTTTCTTCTGCCGGTGCCTCACCAGGCTCTGTAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=9 fanout-score=54.64 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=8.7 sequence=AAGAAGAAGAAG Started job on | Feb 11 11:17:30 Started mapping on | Feb 11 11:17:30 Finished on | Feb 11 11:18:06 Mapping speed, Million of reads per hour | 3767.24 Number of input reads | 37672386 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 33456365 Uniquely mapped reads % | 88.81% Average mapped length | 49.32 Number of splices: Total | 4476314 Number of splices: Annotated (sjdb) | 4406348 Number of splices: GT/AG | 4406149 Number of splices: GC/AG | 56120 Number of splices: AT/AC | 3607 Number of splices: Non-canonical | 10438 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 1.68 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1986362 % of reads mapped to multiple loci | 5.27% Number of reads mapped to too many loci | 1867621 % of reads mapped to too many loci | 4.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.95% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2229659 2229659 2229659 N_multimapping 1986362 1986362 1986362 N_noFeature 1626915 17448122 17494932 N_ambiguous 227410 42657 44905 UnstrandedReadsAssigned:31602040 PositiveStrandReadsAssigned:15965586 NegativeStrandReadsAssigned:15916528 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR3317483 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3317483-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,672,386 reads, 32,449,579 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR3317483.ke.tsv 34699 SRR3317483.se.tsv 87100 total ==> SRR3317483.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1693.37 35.1649 Potri.005G024800.1.v4.1 1035 936 178.024 7.57941 Potri.004G059700.1.v4.1 961 862 31 1.43313 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 479.648 6.72086 Potri.016G087400.1.v4.1 270 171 1451.21 338.195 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 140.805 3.35194 Potri.012G127500.1.v4.1 977 878 29905 1357.32 ==> SRR3317483.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1206 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 718 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3317483 completed mapping pipeline successfully