Starting /dee2/code/volunteer_pipeline.sh SRR3472991 current disk space = 3089347960832 free memory = 1473208500 SRR3472991 SRAfilesize 40e469a94f32f3596d5410a08b9e0de5 SRR3472991.sra SRR3472991.sra file validated SRR3472991 is single end SRR3472991 is conventional basespace SRR3472991 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3472991_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.48175 34.0 31.0 34.0 30.0 34.0 2 32.04425 34.0 31.0 34.0 30.0 34.0 3 32.495 34.0 31.0 34.0 30.0 34.0 4 36.101 37.0 35.0 37.0 35.0 37.0 5 36.18 37.0 35.0 37.0 35.0 37.0 6 36.122 37.0 36.0 37.0 35.0 37.0 7 36.02075 37.0 35.0 37.0 35.0 37.0 8 36.00625 37.0 35.0 37.0 35.0 37.0 9 37.766 39.0 38.0 39.0 35.0 39.0 10-11 37.859375 39.0 38.0 39.0 35.0 39.0 12-13 37.626625000000004 39.0 37.5 39.0 35.0 39.0 14-15 39.076625 41.0 38.5 41.0 36.0 41.0 16-17 39.09325 41.0 39.0 41.0 36.0 41.0 18-19 38.95625 40.5 38.5 41.0 35.0 41.0 20-21 38.988875 40.5 39.0 41.0 35.5 41.0 22-23 39.10025 40.0 39.0 41.0 36.0 41.0 24-25 39.007125 40.5 39.0 41.0 35.5 41.0 26-27 38.6995 40.0 38.0 41.0 34.5 41.0 28-29 38.906000000000006 40.0 39.0 41.0 35.0 41.0 30-31 38.783 40.0 38.0 41.0 35.0 41.0 32-33 38.608 40.0 38.0 41.0 34.0 41.0 34-35 38.68125 40.0 38.0 41.0 34.0 41.0 36-37 38.6225 40.0 38.0 41.0 34.5 41.0 38-39 38.40412499999999 40.0 38.0 41.0 34.0 41.0 40-41 38.433375 40.0 38.0 41.0 34.0 41.0 42-43 38.358875 40.0 38.0 41.0 33.5 41.0 44-45 38.178 40.0 38.0 41.0 33.5 41.0 46-47 38.243125000000006 40.0 38.0 41.0 33.5 41.0 48-49 38.20025 40.0 38.0 41.0 33.0 41.0 50-51 38.017375 40.0 38.0 41.0 33.0 41.0 52-53 37.7805 40.0 37.0 41.0 33.0 41.0 54-55 37.766125 40.0 37.0 41.0 33.0 41.0 56-57 37.536125 39.5 37.0 41.0 32.0 41.0 58-59 37.375625 39.0 36.0 41.0 32.0 41.0 60-61 37.097125 39.0 36.0 40.5 31.5 41.0 62-63 36.852000000000004 39.0 35.5 40.0 31.5 41.0 64-65 36.439625 38.0 35.0 40.0 31.0 41.0 66-67 36.36325 38.0 35.0 40.0 31.5 41.0 68-69 36.294375 37.0 35.0 39.5 31.0 41.0 70-71 35.878125 37.0 35.0 39.0 31.0 41.0 72-73 35.4435 36.0 35.0 39.0 31.0 40.5 74-75 34.956625 36.0 34.0 38.0 30.5 39.5 76-77 34.675 35.5 34.0 37.0 31.0 39.0 78-79 34.316500000000005 35.0 34.0 37.0 30.0 39.0 80-81 34.015 35.0 34.0 36.0 30.0 37.0 82-83 33.756375 35.0 34.0 36.0 30.0 37.0 84-85 33.52275 35.0 34.0 35.5 30.0 37.0 86-87 33.346000000000004 35.0 34.0 35.0 30.0 36.0 88-89 33.182125 35.0 34.0 35.0 29.0 36.0 90-91 33.09425 35.0 34.0 35.0 29.5 36.0 92-93 33.021249999999995 35.0 34.0 35.0 30.0 36.0 94-95 32.88175 35.0 34.0 35.0 29.5 35.0 96-97 32.66525 35.0 34.0 35.0 29.5 35.0 98-99 32.38475 35.0 34.0 35.0 29.0 35.0 100 31.70325 34.0 32.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 2.0 10 1.0 11 3.0 12 5.0 13 1.0 14 4.0 15 5.0 16 5.0 17 7.0 18 7.0 19 4.0 20 6.0 21 6.0 22 6.0 23 6.0 24 18.0 25 13.0 26 19.0 27 34.0 28 33.0 29 35.0 30 51.0 31 66.0 32 82.0 33 112.0 34 162.0 35 246.0 36 479.0 37 964.0 38 1347.0 39 267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.25096525096525 13.462033462033462 14.929214929214929 46.35778635778636 2 17.675 24.3 36.4 21.625 3 20.825 26.125 26.85 26.200000000000003 4 22.825 32.9 20.5 23.775 5 22.525000000000002 35.425000000000004 22.95 19.1 6 19.3 37.15 24.65 18.9 7 16.675 17.925 42.85 22.55 8 19.225 23.075000000000003 29.425 28.275 9 19.175 22.275 31.775 26.775 10-11 22.8875 32.9625 22.3875 21.762500000000003 12-13 20.0625 26.375 29.4875 24.075 14-15 21.4 28.287499999999998 28.1625 22.15 16-17 21.1625 29.15 27.425 22.2625 18-19 21.8125 27.85 27.500000000000004 22.8375 20-21 20.95 28.799999999999997 27.462500000000002 22.787499999999998 22-23 21.925 28.462500000000002 26.8 22.8125 24-25 21.2875 28.599999999999998 27.737499999999997 22.375 26-27 21.7375 28.762500000000003 27.375 22.125 28-29 21.0125 28.775000000000002 26.5375 23.674999999999997 30-31 20.9875 28.9 27.5125 22.6 32-33 21.4875 28.675 26.8375 23.0 34-35 21.85 28.3125 26.924999999999997 22.912499999999998 36-37 21.95 29.062500000000004 26.6125 22.375 38-39 21.3125 28.962500000000002 27.3125 22.412499999999998 40-41 22.1375 28.425 27.3375 22.1 42-43 22.525000000000002 28.5875 26.687499999999996 22.2 44-45 21.575 28.799999999999997 27.6875 21.9375 46-47 21.587500000000002 28.525 27.537499999999998 22.35 48-49 21.65 27.450000000000003 28.237499999999997 22.662499999999998 50-51 21.837500000000002 29.2 27.187499999999996 21.775 52-53 22.0625 28.3375 27.3375 22.2625 54-55 22.287499999999998 27.462500000000002 27.925 22.325 56-57 21.587500000000002 28.287499999999998 27.150000000000002 22.975 58-59 21.075 28.1625 28.675 22.0875 60-61 21.2875 27.975 28.249999999999996 22.4875 62-63 21.6125 28.212500000000002 27.5625 22.6125 64-65 22.15 28.237499999999997 27.237499999999997 22.375 66-67 22.725 28.599999999999998 27.0 21.675 68-69 22.175 27.787499999999998 27.8375 22.2 70-71 22.225 27.900000000000002 27.8125 22.0625 72-73 22.175 27.8875 27.650000000000002 22.287499999999998 74-75 22.037499999999998 27.075 28.512500000000003 22.375 76-77 22.82785348168521 28.053506688336043 27.54094261782723 21.57769721215152 78-79 21.925 27.9125 27.800000000000004 22.3625 80-81 22.8 27.737499999999997 27.6875 21.775 82-83 22.7 27.3375 26.950000000000003 23.0125 84-85 22.440305038129765 27.65345668208526 27.628453556694588 22.277784723090384 86-87 22.145804676753784 27.58534450418907 28.23558834562961 22.033262473427534 88-89 22.115264408051004 27.990998874859358 27.55344418052256 22.340292536567073 90-91 22.740342542817853 28.178522315289413 27.21590198774847 21.865233154144267 92-93 22.2125 27.650000000000002 28.050000000000004 22.0875 94-95 22.6875 28.812500000000004 26.637499999999996 21.8625 96-97 23.1 27.737499999999997 26.650000000000002 22.5125 98-99 22.280570142535634 27.981995498874717 28.032008002000502 21.705426356589147 100 22.875 26.900000000000002 28.325 21.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 2.0 21 2.0 22 0.0 23 0.0 24 1.0 25 1.5 26 2.5 27 4.5 28 8.0 29 10.5 30 10.5 31 15.5 32 25.5 33 33.5 34 38.0 35 58.5 36 80.0 37 98.5 38 131.5 39 161.0 40 187.0 41 205.0 42 236.5 43 271.0 44 274.0 45 276.5 46 271.0 47 272.5 48 256.5 49 215.0 50 189.5 51 157.5 52 130.5 53 105.0 54 71.5 55 53.5 56 41.0 57 22.5 58 18.5 59 19.0 60 12.5 61 10.5 62 8.0 63 2.5 64 1.5 65 1.0 66 1.0 67 1.0 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0125 86-87 0.0375 88-89 0.0125 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.025 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864902 spots for SRR3472991.sra Written 864902 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra Read 864891 spots for SRR3472991.sra Written 864891 spots for SRR3472991.sra SRR ids: ['SRR3472991.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lfuwyr8i SRR3472991.sra spots: 17297831 blocks: [[1, 864891], [864892, 1729782], [1729783, 2594673], [2594674, 3459564], [3459565, 4324455], [4324456, 5189346], [5189347, 6054237], [6054238, 6919128], [6919129, 7784019], [7784020, 8648910], [8648911, 9513801], [9513802, 10378692], [10378693, 11243583], [11243584, 12108474], [12108475, 12973365], [12973366, 13838256], [13838257, 14703147], [14703148, 15568038], [15568039, 16432929], [16432930, 17297831]] SRR3472991 file size 4727457 SRR3472991 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3472991 SRR3472991_1.fastq Input file: SRR3472991_1.fastq trimmed: SRR3472991-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 22:59:53 2025 >> started Thu Feb 13 23:00:03 2025 >> done (10.123s) 17297831 reads processed; of these: 10040 ( 0.06%) short reads filtered out after trimming by size control 14479 ( 0.08%) empty reads filtered out after trimming by size control 17273312 (99.86%) reads available; of these: 1162284 ( 6.73%) trimmed reads available after processing 16111028 (93.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1028 0.01% 19 1212 0.01% 20 2100 0.01% 21 1522 0.01% 22 1750 0.01% 23 2089 0.01% 24 2379 0.01% 25 3002 0.02% 26 2873 0.02% 27 2876 0.02% 28 3095 0.02% 29 3361 0.02% 30 3484 0.02% 31 3331 0.02% 32 3358 0.02% 33 3494 0.02% 34 3637 0.02% 35 3802 0.02% 36 4134 0.02% 37 4230 0.02% 38 4657 0.03% 39 4685 0.03% 40 5040 0.03% 41 5341 0.03% 42 5454 0.03% 43 5703 0.03% 44 6173 0.04% 45 6578 0.04% 46 6646 0.04% 47 6995 0.04% 48 7181 0.04% 49 7689 0.04% 50 7809 0.05% 51 7956 0.05% 52 8154 0.05% 53 8411 0.05% 54 8457 0.05% 55 8518 0.05% 56 8378 0.05% 57 8680 0.05% 58 8905 0.05% 59 9016 0.05% 60 9255 0.05% 61 9995 0.06% 62 9435 0.05% 63 9426 0.05% 64 9638 0.06% 65 10098 0.06% 66 9612 0.06% 67 10490 0.06% 68 10779 0.06% 69 10005 0.06% 70 10402 0.06% 71 10632 0.06% 72 11024 0.06% 73 11058 0.06% 74 11600 0.07% 75 11466 0.07% 76 11866 0.07% 77 12416 0.07% 78 13325 0.08% 79 13854 0.08% 80 14894 0.09% 81 15504 0.09% 82 15827 0.09% 83 16847 0.10% 84 18017 0.10% 85 19587 0.11% 86 20641 0.12% 87 22479 0.13% 88 25278 0.15% 89 26811 0.16% 90 30208 0.17% 91 33596 0.19% 92 38870 0.23% 93 45261 0.26% 94 52526 0.30% 95 60996 0.35% 96 69188 0.40% 97 73149 0.42% 98 71853 0.42% 99 61193 0.35% 100 16111028 93.27% 17273312 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=60.88 fanout-score-rank=5 prefix-density=1.26 prefix-fanout=40.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=294.50 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=18.8 sequence=CTTCTCTTCATTGTTTGCTTTAGAAAAAATCATGGAAGTTCTCACATTCACTGAGGAGTTCTCCAGCCCCGCCGCGGCTAAAAGGTTGTTCACGGCCATGGTACTTGAGGCTGACACCCTCATTCCCAAGCTCGTGCCGCAGGCTGTGAAGAGTATTGAAACAATCAAAGGAAATGGAGGCCCTGGGACTATCAAGAAGTTGACCTTTGCCGAAGGTAAGTATGCGAAGACCAGGATTGATGCAGTGGACAAAGTCAACCTGACTCATAGCTACACAACAATTGAGGGTGTTCCTTTGCTGGGCAAATTTGAATCAATTGCTTATGATATGAAGTTTGAGGCCACCCCTGAAGGAGGATGCAAAACTAAAGTGGTGTGCAAGTATTTCCCAAAACCAGGTGCTGAAATAAAGGAAGAGGAAATTAAGGAAGGCAAGGAAAAGGCTGCAGCAGTTTACAAGGCTGTGGAAACCTACGTAGTTGCAAATCCTCAGGCCTACGCATAATGA Started job on | Feb 13 23:00:21 Started mapping on | Feb 13 23:00:21 Finished on | Feb 13 23:00:39 Mapping speed, Million of reads per hour | 3454.66 Number of input reads | 17273312 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 16220514 Uniquely mapped reads % | 93.91% Average mapped length | 98.29 Number of splices: Total | 5134512 Number of splices: Annotated (sjdb) | 5068098 Number of splices: GT/AG | 5035949 Number of splices: GC/AG | 82856 Number of splices: AT/AC | 4766 Number of splices: Non-canonical | 10941 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 1.83 Insertion rate per base | 0.01% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 852340 % of reads mapped to multiple loci | 4.93% Number of reads mapped to too many loci | 46918 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 200458 200458 200458 N_multimapping 852340 852340 852340 N_noFeature 338602 8387515 8105384 N_ambiguous 123155 28364 28763 UnstrandedReadsAssigned:15758757 PositiveStrandReadsAssigned:7804635 NegativeStrandReadsAssigned:8086367 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3472991 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3472991-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,273,312 reads, 16,441,849 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52401 SRR3472991.ke.tsv 34699 SRR3472991.se.tsv 87100 total ==> SRR3472991.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 473 18.5308 Potri.005G024800.1.v4.1 1035 936 50 4.01608 Potri.004G059700.1.v4.1 961 862 29 2.52929 Potri.007G009000.2.v4.1 1416 1317 1 0.0570851 Potri.003G141000.2.v4.1 2943 2844 673.932 17.8154 Potri.016G087400.1.v4.1 270 171 765 336.336 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 34 1.52698 Potri.012G127500.1.v4.1 977 878 5468 468.212 ==> SRR3472991.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 443 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3472991 completed mapping pipeline successfully