Starting /dee2/code/volunteer_pipeline.sh SRR3472992 current disk space = 3089300103168 free memory = 1503345788 SRR3472992 SRAfilesize 74db87cd69102ce0d65c285b537ae409 SRR3472992.sra SRR3472992.sra file validated SRR3472992 is single end SRR3472992 is conventional basespace SRR3472992 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3472992_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.94325 34.0 31.0 34.0 30.0 34.0 2 32.3395 34.0 31.0 34.0 30.0 34.0 3 32.6705 34.0 31.0 34.0 31.0 34.0 4 36.179 37.0 35.0 37.0 35.0 37.0 5 36.24475 37.0 37.0 37.0 35.0 37.0 6 36.16075 37.0 37.0 37.0 35.0 37.0 7 36.08375 37.0 36.0 37.0 35.0 37.0 8 36.02825 37.0 36.0 37.0 35.0 37.0 9 37.82075 39.0 38.0 39.0 35.0 39.0 10-11 37.837374999999994 39.0 38.0 39.0 35.0 39.0 12-13 37.654250000000005 39.0 38.0 39.0 35.0 39.0 14-15 39.128875 41.0 39.0 41.0 36.0 41.0 16-17 39.17575 41.0 39.0 41.0 36.0 41.0 18-19 39.117625000000004 41.0 38.5 41.0 36.0 41.0 20-21 39.084500000000006 41.0 39.0 41.0 35.5 41.0 22-23 39.1045 41.0 39.0 41.0 36.0 41.0 24-25 39.09125 41.0 39.0 41.0 36.0 41.0 26-27 38.730625 40.0 38.5 41.0 34.5 41.0 28-29 38.906875 40.5 38.5 41.0 35.0 41.0 30-31 38.93525 40.0 39.0 41.0 35.5 41.0 32-33 38.679625 40.0 38.0 41.0 34.5 41.0 34-35 38.7715 40.0 38.0 41.0 34.5 41.0 36-37 38.72525 40.0 38.0 41.0 35.0 41.0 38-39 38.54175 40.0 38.0 41.0 34.0 41.0 40-41 38.6015 40.0 38.0 41.0 34.5 41.0 42-43 38.548500000000004 40.0 38.0 41.0 34.0 41.0 44-45 38.284875 40.0 38.0 41.0 33.5 41.0 46-47 38.333749999999995 40.0 38.0 41.0 34.0 41.0 48-49 38.207625 40.0 38.0 41.0 33.0 41.0 50-51 38.117625000000004 40.0 38.0 41.0 33.0 41.0 52-53 37.951125000000005 40.0 37.0 41.0 33.0 41.0 54-55 37.827875000000006 40.0 37.0 41.0 33.0 41.0 56-57 37.64 40.0 37.0 41.0 33.0 41.0 58-59 37.42 39.0 36.5 41.0 32.0 41.0 60-61 37.160624999999996 39.0 36.0 41.0 32.0 41.0 62-63 36.81375 39.0 35.5 40.0 31.5 41.0 64-65 36.465625 38.0 35.0 40.0 31.0 41.0 66-67 36.460750000000004 38.0 35.0 40.0 31.5 41.0 68-69 36.393625 37.0 35.0 40.0 31.5 41.0 70-71 35.926875 37.0 35.0 39.0 31.0 41.0 72-73 35.622625 36.5 35.0 39.0 31.0 40.5 74-75 35.1095 36.0 35.0 38.5 30.5 39.5 76-77 34.804 35.5 35.0 37.0 31.0 39.0 78-79 34.446 35.0 34.0 37.0 31.0 39.0 80-81 34.1555 35.0 34.0 36.5 31.0 37.5 82-83 33.878625 35.0 34.0 36.0 30.5 37.0 84-85 33.69025 35.0 34.0 36.0 30.5 37.0 86-87 33.533500000000004 35.0 34.0 35.0 30.5 36.0 88-89 33.330749999999995 35.0 34.0 35.0 30.0 36.0 90-91 33.250875 35.0 34.0 35.0 30.0 36.0 92-93 33.1745 35.0 34.0 35.0 30.0 35.5 94-95 33.099625 35.0 34.0 35.0 30.0 35.0 96-97 32.890625 35.0 34.0 35.0 29.5 35.0 98-99 32.6325 35.0 34.0 35.0 29.5 35.0 100 31.91525 35.0 32.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 2.0 7 0.0 8 1.0 9 2.0 10 1.0 11 5.0 12 4.0 13 3.0 14 2.0 15 6.0 16 5.0 17 5.0 18 5.0 19 5.0 20 2.0 21 5.0 22 9.0 23 5.0 24 11.0 25 12.0 26 9.0 27 20.0 28 30.0 29 47.0 30 54.0 31 71.0 32 95.0 33 132.0 34 146.0 35 227.0 36 394.0 37 936.0 38 1437.0 39 311.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.76457113769407 12.420463222193941 15.576482565538305 47.238483074573686 2 18.05 23.1 38.2 20.65 3 20.375 25.724999999999998 27.625 26.275 4 24.5 31.7 19.650000000000002 24.15 5 23.5 36.375 21.65 18.475 6 18.825 37.974999999999994 23.400000000000002 19.8 7 16.825000000000003 19.125 41.825 22.225 8 18.575 23.425 30.775000000000002 27.224999999999998 9 19.775000000000002 24.025 30.825000000000003 25.374999999999996 10-11 22.8375 33.900000000000006 22.4625 20.8 12-13 19.950000000000003 26.6 29.612500000000004 23.8375 14-15 21.6125 26.674999999999997 27.875 23.8375 16-17 21.762500000000003 28.1 27.275 22.8625 18-19 21.4 28.262500000000003 27.775 22.5625 20-21 22.125 28.65 26.875 22.35 22-23 21.8125 27.900000000000002 27.5125 22.775000000000002 24-25 21.075 29.025000000000002 26.9625 22.9375 26-27 21.4125 28.299999999999997 27.224999999999998 23.0625 28-29 22.400000000000002 27.825 27.6 22.175 30-31 21.875 28.999999999999996 26.650000000000002 22.475 32-33 21.65 28.6625 27.8375 21.85 34-35 22.025 28.525 26.687499999999996 22.7625 36-37 22.6 27.1125 27.762500000000003 22.525000000000002 38-39 21.875 28.487499999999997 27.0875 22.55 40-41 21.637500000000003 28.325 27.762500000000003 22.275 42-43 21.425 28.749999999999996 27.8875 21.9375 44-45 22.1 27.775 27.950000000000003 22.175 46-47 22.15 28.212500000000002 27.5625 22.075 48-49 22.25 27.712500000000002 27.750000000000004 22.287499999999998 50-51 22.0875 28.125 27.6 22.1875 52-53 22.3625 27.750000000000004 27.6625 22.225 54-55 22.3875 27.6375 27.0875 22.8875 56-57 21.025 28.375 28.1125 22.4875 58-59 22.2625 28.6125 26.6125 22.5125 60-61 22.037499999999998 27.85 27.3 22.8125 62-63 22.175 27.775 28.287499999999998 21.762500000000003 64-65 22.375 28.499999999999996 27.400000000000002 21.725 66-67 22.225 27.500000000000004 28.262500000000003 22.0125 68-69 21.462500000000002 28.3375 28.1875 22.0125 70-71 22.25 27.125 27.8625 22.7625 72-73 22.25 28.4 26.875 22.475 74-75 22.537499999999998 27.6125 27.3875 22.4625 76-77 22.425 28.199999999999996 27.700000000000003 21.675 78-79 21.375 27.6625 28.462500000000002 22.5 80-81 21.349999999999998 28.975 27.750000000000004 21.925 82-83 22.2625 27.487499999999997 28.037499999999998 22.2125 84-85 22.6375 28.075 27.9375 21.349999999999998 86-87 22.66816704176044 27.74443610902726 26.894223555888974 22.693173293323333 88-89 21.77772221527691 27.590948868608578 28.27853481685211 22.352794099262407 90-91 21.840230028753595 28.216027003375423 27.378422302787847 22.565320665083135 92-93 22.162499999999998 27.950000000000003 27.425 22.4625 94-95 22.825 27.712500000000002 27.6875 21.775 96-97 22.075 28.3125 26.85 22.7625 98-99 22.775000000000002 27.4125 27.212500000000002 22.6 100 22.0 28.625 26.325 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.5 25 2.5 26 2.5 27 3.0 28 8.0 29 14.5 30 11.5 31 12.0 32 28.0 33 37.5 34 42.5 35 52.0 36 72.0 37 96.0 38 123.0 39 163.0 40 191.5 41 226.0 42 244.5 43 258.5 44 271.0 45 265.5 46 269.5 47 270.5 48 245.0 49 218.5 50 191.5 51 153.0 52 119.0 53 92.0 54 76.5 55 60.0 56 45.5 57 34.5 58 27.5 59 19.5 60 14.5 61 9.0 62 5.0 63 5.0 64 3.0 65 1.5 66 1.5 67 1.5 68 1.5 69 1.0 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.025 88-89 0.0125 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4526024641689716 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025144581342720643 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 6 0.15 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460847 spots for SRR3472992.sra Written 460847 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra Read 460828 spots for SRR3472992.sra Written 460828 spots for SRR3472992.sra SRR ids: ['SRR3472992.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w626xrrr SRR3472992.sra spots: 9216579 blocks: [[1, 460828], [460829, 921656], [921657, 1382484], [1382485, 1843312], [1843313, 2304140], [2304141, 2764968], [2764969, 3225796], [3225797, 3686624], [3686625, 4147452], [4147453, 4608280], [4608281, 5069108], [5069109, 5529936], [5529937, 5990764], [5990765, 6451592], [6451593, 6912420], [6912421, 7373248], [7373249, 7834076], [7834077, 8294904], [8294905, 8755732], [8755733, 9216579]] SRR3472992 file size 2514574 SRR3472992 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3472992 SRR3472992_1.fastq Input file: SRR3472992_1.fastq trimmed: SRR3472992-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 23:19:24 2025 >> started Thu Feb 13 23:19:29 2025 >> done (4.683s) 9216579 reads processed; of these: 3462 ( 0.04%) short reads filtered out after trimming by size control 22691 ( 0.25%) empty reads filtered out after trimming by size control 9190426 (99.72%) reads available; of these: 529667 ( 5.76%) trimmed reads available after processing 8660759 (94.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 369 0.00% 19 421 0.00% 20 477 0.01% 21 560 0.01% 22 680 0.01% 23 831 0.01% 24 938 0.01% 25 1097 0.01% 26 1167 0.01% 27 1127 0.01% 28 1163 0.01% 29 1443 0.02% 30 1436 0.02% 31 1288 0.01% 32 1328 0.01% 33 1380 0.02% 34 1490 0.02% 35 1524 0.02% 36 1622 0.02% 37 1792 0.02% 38 1906 0.02% 39 1954 0.02% 40 2102 0.02% 41 2310 0.03% 42 2277 0.02% 43 2348 0.03% 44 2458 0.03% 45 2661 0.03% 46 2804 0.03% 47 2801 0.03% 48 3020 0.03% 49 3066 0.03% 50 3222 0.04% 51 3243 0.04% 52 3430 0.04% 53 3527 0.04% 54 3542 0.04% 55 3604 0.04% 56 3496 0.04% 57 3716 0.04% 58 3816 0.04% 59 3861 0.04% 60 4011 0.04% 61 4281 0.05% 62 4083 0.04% 63 4183 0.05% 64 4340 0.05% 65 4395 0.05% 66 4418 0.05% 67 4504 0.05% 68 4876 0.05% 69 4334 0.05% 70 4637 0.05% 71 4575 0.05% 72 4753 0.05% 73 5009 0.05% 74 4974 0.05% 75 5111 0.06% 76 5406 0.06% 77 5670 0.06% 78 5852 0.06% 79 6107 0.07% 80 6525 0.07% 81 6899 0.08% 82 7066 0.08% 83 7741 0.08% 84 8276 0.09% 85 8960 0.10% 86 9596 0.10% 87 10320 0.11% 88 11699 0.13% 89 12476 0.14% 90 13864 0.15% 91 15699 0.17% 92 18169 0.20% 93 21116 0.23% 94 24752 0.27% 95 28879 0.31% 96 32829 0.36% 97 35955 0.39% 98 35120 0.38% 99 30910 0.34% 100 8660759 94.24% 9190426 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=60.85 fanout-score-rank=3 prefix-density=1.25 prefix-fanout=41.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=77.95 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.4 sequence=CTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTG Started job on | Feb 13 23:19:44 Started mapping on | Feb 13 23:19:44 Finished on | Feb 13 23:19:57 Mapping speed, Million of reads per hour | 2545.04 Number of input reads | 9190426 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 8642160 Uniquely mapped reads % | 94.03% Average mapped length | 98.49 Number of splices: Total | 2796512 Number of splices: Annotated (sjdb) | 2760610 Number of splices: GT/AG | 2748053 Number of splices: GC/AG | 39081 Number of splices: AT/AC | 2696 Number of splices: Non-canonical | 6682 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 1.66 Insertion rate per base | 0.01% Insertion average length | 1.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409044 % of reads mapped to multiple loci | 4.45% Number of reads mapped to too many loci | 67527 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.78% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 139222 139222 139222 N_multimapping 409044 409044 409044 N_noFeature 189303 4467346 4329173 N_ambiguous 70143 17468 17816 UnstrandedReadsAssigned:8382714 PositiveStrandReadsAssigned:4157346 NegativeStrandReadsAssigned:4295171 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3472992 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3472992-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,190,426 reads, 8,754,179 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR3472992.ke.tsv 34699 SRR3472992.se.tsv 87100 total ==> SRR3472992.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 233 15.1895 Potri.005G024800.1.v4.1 1035 936 48.0039 6.41598 Potri.004G059700.1.v4.1 961 862 26 3.77336 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 293.32 12.9025 Potri.016G087400.1.v4.1 270 171 478 349.699 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 27 2.01777 Potri.012G127500.1.v4.1 977 878 5698 811.878 ==> SRR3472992.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 124 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 172 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3472992 completed mapping pipeline successfully