Starting /dee2/code/volunteer_pipeline.sh SRR3472993 current disk space = 3089239883776 free memory = 1491864080 SRR3472993 SRAfilesize b96b4c7d80f097ffbc2546d70fd917d8 SRR3472993.sra SRR3472993.sra file validated SRR3472993 is single end SRR3472993 is conventional basespace SRR3472993 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3472993_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.33775 34.0 31.0 34.0 31.0 34.0 2 32.68725 34.0 31.0 34.0 31.0 34.0 3 32.88425 34.0 31.0 34.0 31.0 34.0 4 36.306 37.0 37.0 37.0 35.0 37.0 5 36.3475 37.0 37.0 37.0 35.0 37.0 6 36.22575 37.0 37.0 37.0 35.0 37.0 7 36.2635 37.0 37.0 37.0 35.0 37.0 8 36.2565 37.0 37.0 37.0 35.0 37.0 9 38.0845 39.0 39.0 39.0 37.0 39.0 10-11 37.9965 39.0 39.0 39.0 35.0 39.0 12-13 37.9875 39.0 38.5 39.0 35.0 39.0 14-15 39.49912500000001 41.0 39.0 41.0 36.5 41.0 16-17 39.48225 41.0 39.0 41.0 37.0 41.0 18-19 39.451375 41.0 39.0 41.0 36.5 41.0 20-21 39.4655 41.0 39.0 41.0 37.0 41.0 22-23 39.350125 41.0 39.0 41.0 36.5 41.0 24-25 39.476875 41.0 39.5 41.0 37.0 41.0 26-27 39.415375 41.0 39.0 41.0 36.5 41.0 28-29 39.27075 41.0 39.0 41.0 36.0 41.0 30-31 39.254875 41.0 39.0 41.0 36.0 41.0 32-33 39.244749999999996 41.0 39.0 41.0 36.0 41.0 34-35 39.272499999999994 41.0 39.0 41.0 36.0 41.0 36-37 39.225 41.0 39.0 41.0 36.0 41.0 38-39 39.20275 41.0 39.0 41.0 35.5 41.0 40-41 39.0785 41.0 39.0 41.0 35.0 41.0 42-43 39.053625 41.0 39.0 41.0 35.0 41.0 44-45 39.04575 41.0 39.0 41.0 35.0 41.0 46-47 38.98625 41.0 39.0 41.0 35.0 41.0 48-49 38.853750000000005 40.5 39.0 41.0 35.0 41.0 50-51 38.7615 40.0 38.5 41.0 35.0 41.0 52-53 38.638999999999996 40.0 38.0 41.0 35.0 41.0 54-55 38.492374999999996 40.0 38.0 41.0 34.5 41.0 56-57 38.184875000000005 40.0 37.5 41.0 34.0 41.0 58-59 38.067125000000004 40.0 37.0 41.0 33.5 41.0 60-61 37.869875 40.0 37.0 41.0 33.5 41.0 62-63 37.64025 39.0 36.5 41.0 33.0 41.0 64-65 37.394875 39.0 36.0 41.0 33.0 41.0 66-67 37.043125 39.0 35.0 40.5 33.0 41.0 68-69 36.667249999999996 37.5 35.0 40.0 32.5 41.0 70-71 36.28375 37.0 35.0 39.0 32.0 41.0 72-73 35.878125 36.5 35.0 39.0 32.0 40.5 74-75 35.607124999999996 36.0 35.0 39.0 32.0 39.5 76-77 35.145125 36.0 35.0 37.0 32.0 39.0 78-79 34.701375 35.0 35.0 37.0 31.0 39.0 80-81 34.4645 35.0 35.0 36.5 31.0 38.0 82-83 34.126999999999995 35.0 34.0 36.0 31.0 37.0 84-85 34.12575 35.0 35.0 36.0 31.5 37.0 86-87 33.835875 35.0 34.0 35.5 31.0 36.5 88-89 33.663875000000004 35.0 34.0 35.0 31.0 36.0 90-91 33.629625000000004 35.0 34.0 35.0 31.5 36.0 92-93 33.62825 35.0 34.0 35.0 31.5 36.0 94-95 33.479625 35.0 34.0 35.0 31.5 35.5 96-97 33.435625 35.0 34.0 35.0 31.5 35.0 98-99 33.314750000000004 35.0 34.0 35.0 31.0 35.0 100 33.02175 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 2.0 11 0.0 12 5.0 13 5.0 14 4.0 15 6.0 16 0.0 17 1.0 18 5.0 19 5.0 20 5.0 21 6.0 22 5.0 23 5.0 24 5.0 25 11.0 26 17.0 27 12.0 28 23.0 29 35.0 30 40.0 31 59.0 32 66.0 33 79.0 34 121.0 35 164.0 36 340.0 37 862.0 38 1635.0 39 475.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.753725688305128 13.488254609749935 15.28163677696388 46.47638292498106 2 18.125 22.425 37.724999999999994 21.725 3 21.55 25.775 26.5 26.174999999999997 4 23.3 31.225 21.224999999999998 24.25 5 23.1 35.55 22.925 18.425 6 19.0 37.65 23.375 19.975 7 16.575 18.85 43.375 21.2 8 18.925 24.55 29.349999999999998 27.175 9 21.075 23.25 31.0 24.675 10-11 23.1125 33.875 21.6125 21.4 12-13 20.225 25.825 30.2375 23.7125 14-15 20.549999999999997 27.5625 29.012500000000003 22.875 16-17 21.8125 28.4125 26.6 23.175 18-19 22.25 28.3625 26.3625 23.025000000000002 20-21 22.0625 27.6375 27.437499999999996 22.8625 22-23 21.5625 28.65 26.950000000000003 22.8375 24-25 20.9875 28.6125 27.425 22.975 26-27 20.6625 29.225 26.8375 23.275000000000002 28-29 21.3625 27.625 27.800000000000004 23.2125 30-31 22.3375 27.762500000000003 27.962500000000002 21.9375 32-33 21.1875 29.125 27.35 22.3375 34-35 22.1875 28.712500000000002 26.887499999999996 22.2125 36-37 21.512500000000003 29.175 26.9625 22.35 38-39 21.675 27.6875 27.575 23.0625 40-41 21.6625 27.787499999999998 27.525 23.025000000000002 42-43 21.65 28.9875 27.1 22.2625 44-45 22.0 27.474999999999998 27.5875 22.9375 46-47 21.975 28.3375 27.55 22.1375 48-49 22.162499999999998 27.437499999999996 27.800000000000004 22.6 50-51 21.85 27.900000000000002 28.225 22.025 52-53 22.662499999999998 27.1375 27.35 22.85 54-55 22.2125 28.175 26.887499999999996 22.725 56-57 21.637500000000003 28.549999999999997 27.925 21.8875 58-59 21.7875 27.925 27.5875 22.7 60-61 22.2 27.3125 28.487499999999997 22.0 62-63 22.025 27.450000000000003 27.700000000000003 22.825 64-65 21.85 28.1375 27.8625 22.15 66-67 21.75 28.025 27.425 22.8 68-69 21.9 27.712500000000002 27.950000000000003 22.4375 70-71 22.35 27.3625 27.1 23.1875 72-73 21.762500000000003 27.650000000000002 27.9125 22.675 74-75 22.1875 28.075 27.487499999999997 22.25 76-77 22.6125 27.875 27.1 22.412499999999998 78-79 22.1 27.8625 27.6875 22.35 80-81 21.1625 28.1125 29.0875 21.637500000000003 82-83 22.400000000000002 27.437499999999996 27.950000000000003 22.2125 84-85 22.625 28.012500000000003 27.762500000000003 21.6 86-87 22.5625 27.800000000000004 28.075 21.5625 88-89 22.35 27.875 28.487499999999997 21.2875 90-91 23.05 27.825 27.150000000000002 21.975 92-93 21.987499999999997 27.750000000000004 27.775 22.4875 94-95 22.075 28.5625 26.974999999999998 22.3875 96-97 21.975 28.425 27.8375 21.762500000000003 98-99 22.6125 28.225 27.5875 21.575 100 22.475 28.999999999999996 26.6 21.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 2.0 26 4.0 27 5.5 28 5.5 29 8.5 30 12.5 31 14.0 32 22.5 33 38.5 34 47.5 35 57.5 36 82.5 37 114.0 38 137.0 39 142.0 40 163.0 41 197.5 42 247.0 43 286.0 44 286.0 45 274.5 46 273.0 47 263.0 48 232.5 49 201.5 50 184.0 51 162.0 52 126.0 53 95.5 54 73.5 55 67.5 56 53.5 57 36.5 58 22.5 59 12.5 60 11.5 61 9.5 62 7.0 63 4.5 64 2.5 65 2.0 66 2.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.0875 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra Read 510248 spots for SRR3472993.sra Written 510248 spots for SRR3472993.sra Read 510244 spots for SRR3472993.sra Written 510244 spots for SRR3472993.sra SRR ids: ['SRR3472993.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tyfvewzs SRR3472993.sra spots: 10204884 blocks: [[1, 510244], [510245, 1020488], [1020489, 1530732], [1530733, 2040976], [2040977, 2551220], [2551221, 3061464], [3061465, 3571708], [3571709, 4081952], [4081953, 4592196], [4592197, 5102440], [5102441, 5612684], [5612685, 6122928], [6122929, 6633172], [6633173, 7143416], [7143417, 7653660], [7653661, 8163904], [8163905, 8674148], [8674149, 9184392], [9184393, 9694636], [9694637, 10204884]] SRR3472993 file size 2784477 SRR3472993 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3472993 SRR3472993_1.fastq Input file: SRR3472993_1.fastq trimmed: SRR3472993-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 23:29:52 2025 >> started Thu Feb 13 23:29:57 2025 >> done (5.319s) 10204884 reads processed; of these: 3669 ( 0.04%) short reads filtered out after trimming by size control 16177 ( 0.16%) empty reads filtered out after trimming by size control 10185038 (99.81%) reads available; of these: 502934 ( 4.94%) trimmed reads available after processing 9682104 (95.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 412 0.00% 19 468 0.00% 20 1948 0.02% 21 590 0.01% 22 762 0.01% 23 812 0.01% 24 909 0.01% 25 1145 0.01% 26 1105 0.01% 27 1153 0.01% 28 1186 0.01% 29 1255 0.01% 30 1245 0.01% 31 1304 0.01% 32 1359 0.01% 33 1356 0.01% 34 1458 0.01% 35 1552 0.02% 36 1750 0.02% 37 1761 0.02% 38 1883 0.02% 39 1927 0.02% 40 2023 0.02% 41 2107 0.02% 42 2155 0.02% 43 2352 0.02% 44 2444 0.02% 45 2591 0.03% 46 2667 0.03% 47 2871 0.03% 48 2931 0.03% 49 3042 0.03% 50 3071 0.03% 51 3211 0.03% 52 3413 0.03% 53 3470 0.03% 54 3514 0.03% 55 3482 0.03% 56 3572 0.04% 57 3707 0.04% 58 3675 0.04% 59 3848 0.04% 60 4034 0.04% 61 4111 0.04% 62 4035 0.04% 63 4027 0.04% 64 4180 0.04% 65 4462 0.04% 66 4580 0.04% 67 4815 0.05% 68 4825 0.05% 69 4636 0.05% 70 4469 0.04% 71 4705 0.05% 72 4892 0.05% 73 4728 0.05% 74 5106 0.05% 75 5262 0.05% 76 5303 0.05% 77 5523 0.05% 78 5729 0.06% 79 5917 0.06% 80 6168 0.06% 81 6448 0.06% 82 6682 0.07% 83 6864 0.07% 84 7128 0.07% 85 7974 0.08% 86 8582 0.08% 87 9426 0.09% 88 10539 0.10% 89 11717 0.12% 90 13328 0.13% 91 15142 0.15% 92 16905 0.17% 93 19654 0.19% 94 23272 0.23% 95 28621 0.28% 96 30732 0.30% 97 31777 0.31% 98 35512 0.35% 99 23638 0.23% 100 9682104 95.06% 10185038 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=59.95 fanout-score-rank=6 prefix-density=1.03 prefix-fanout=40.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=361.54 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=31.3 sequence=CTTCTTCTTCTC Started job on | Feb 13 23:30:14 Started mapping on | Feb 13 23:30:15 Finished on | Feb 13 23:30:28 Mapping speed, Million of reads per hour | 2820.47 Number of input reads | 10185038 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 9605071 Uniquely mapped reads % | 94.31% Average mapped length | 98.66 Number of splices: Total | 3058678 Number of splices: Annotated (sjdb) | 3018709 Number of splices: GT/AG | 3005198 Number of splices: GC/AG | 42797 Number of splices: AT/AC | 3150 Number of splices: Non-canonical | 7533 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398139 % of reads mapped to multiple loci | 3.91% Number of reads mapped to too many loci | 103203 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.77% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 181828 181828 181828 N_multimapping 398139 398139 398139 N_noFeature 203919 4953419 4816756 N_ambiguous 76205 18782 18700 UnstrandedReadsAssigned:9324947 PositiveStrandReadsAssigned:4632870 NegativeStrandReadsAssigned:4769615 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3472993 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3472993-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,185,038 reads, 9,713,575 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR3472993.ke.tsv 34699 SRR3472993.se.tsv 87100 total ==> SRR3472993.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 243 14.105 Potri.005G024800.1.v4.1 1035 936 75 8.92539 Potri.004G059700.1.v4.1 961 862 27 3.48898 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 363.469 14.2357 Potri.016G087400.1.v4.1 270 171 621 404.517 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 22 1.46389 Potri.012G127500.1.v4.1 977 878 6423 814.864 ==> SRR3472993.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 165 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 164 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3472993 completed mapping pipeline successfully