Starting /dee2/code/volunteer_pipeline.sh SRR3472994 current disk space = 3089301999616 free memory = 1579917932 SRR3472994 SRAfilesize efd0651fcaa14c43dd1e251f6ea0cccc SRR3472994.sra SRR3472994.sra file validated SRR3472994 is single end SRR3472994 is conventional basespace SRR3472994 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3472994_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.71 34.0 31.0 34.0 30.0 34.0 2 32.2545 34.0 31.0 34.0 30.0 34.0 3 32.596 34.0 31.0 34.0 30.0 34.0 4 36.15825 37.0 35.0 37.0 35.0 37.0 5 36.16525 37.0 35.0 37.0 35.0 37.0 6 36.105 37.0 36.0 37.0 35.0 37.0 7 36.0405 37.0 36.0 37.0 35.0 37.0 8 36.0115 37.0 36.0 37.0 35.0 37.0 9 37.741 39.0 38.0 39.0 35.0 39.0 10-11 37.775999999999996 39.0 38.0 39.0 35.0 39.0 12-13 37.589124999999996 39.0 37.5 39.0 35.0 39.0 14-15 39.082125 41.0 39.0 41.0 36.0 41.0 16-17 39.05325 41.0 39.0 41.0 35.5 41.0 18-19 39.057249999999996 41.0 38.5 41.0 36.0 41.0 20-21 38.956500000000005 40.5 39.0 41.0 35.5 41.0 22-23 38.98475 40.0 39.0 41.0 35.0 41.0 24-25 38.96875 40.5 39.0 41.0 35.5 41.0 26-27 38.655375 40.0 38.0 41.0 34.5 41.0 28-29 38.862125 40.0 38.5 41.0 35.0 41.0 30-31 38.7455 40.0 38.0 41.0 35.0 41.0 32-33 38.630375 40.0 38.0 41.0 35.0 41.0 34-35 38.75625 40.0 38.0 41.0 35.0 41.0 36-37 38.683875 40.0 38.0 41.0 35.0 41.0 38-39 38.481375 40.0 38.0 41.0 34.5 41.0 40-41 38.508875 40.0 38.0 41.0 34.5 41.0 42-43 38.47075 40.0 38.0 41.0 34.0 41.0 44-45 38.208875 40.0 38.0 41.0 33.0 41.0 46-47 38.171499999999995 40.0 38.0 41.0 33.0 41.0 48-49 38.076875 40.0 38.0 41.0 33.0 41.0 50-51 37.99875 40.0 37.0 41.0 33.0 41.0 52-53 37.78075 40.0 37.0 41.0 32.5 41.0 54-55 37.754625000000004 40.0 37.0 41.0 33.0 41.0 56-57 37.576125000000005 39.5 36.5 41.0 32.5 41.0 58-59 37.355999999999995 39.0 36.0 41.0 32.0 41.0 60-61 37.035124999999994 39.0 35.5 40.5 31.5 41.0 62-63 36.7585 38.5 35.0 40.0 31.0 41.0 64-65 36.3775 38.0 35.0 40.0 30.5 41.0 66-67 36.31125 38.0 35.0 40.0 31.0 41.0 68-69 36.184625 37.0 35.0 39.5 31.0 41.0 70-71 35.84225 37.0 35.0 39.0 31.0 41.0 72-73 35.448750000000004 36.0 35.0 39.0 31.0 40.5 74-75 34.880624999999995 36.0 34.5 37.5 30.5 39.5 76-77 34.6105 35.0 34.0 37.0 30.5 39.0 78-79 34.2575 35.0 34.0 37.0 30.5 39.0 80-81 33.91675 35.0 34.0 36.0 30.5 37.0 82-83 33.534875 35.0 34.0 36.0 29.5 37.0 84-85 33.338875 35.0 34.0 35.0 29.0 36.5 86-87 33.200374999999994 35.0 34.0 35.0 29.5 36.0 88-89 33.064625 35.0 34.0 35.0 29.5 36.0 90-91 32.98975 35.0 34.0 35.0 29.0 36.0 92-93 32.8595 35.0 34.0 35.0 29.0 35.5 94-95 32.764125 35.0 34.0 35.0 29.5 35.0 96-97 32.643125 35.0 34.0 35.0 29.0 35.0 98-99 32.447874999999996 35.0 33.5 35.0 29.0 35.0 100 31.71775 34.0 32.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 1.0 7 1.0 8 1.0 9 6.0 10 1.0 11 3.0 12 2.0 13 2.0 14 4.0 15 0.0 16 2.0 17 7.0 18 3.0 19 6.0 20 2.0 21 8.0 22 4.0 23 10.0 24 9.0 25 14.0 26 32.0 27 23.0 28 42.0 29 54.0 30 57.0 31 64.0 32 88.0 33 116.0 34 161.0 35 270.0 36 439.0 37 920.0 38 1364.0 39 282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.838668373879642 13.316261203585148 15.749039692701663 45.096030729833544 2 18.425 22.975 35.675000000000004 22.925 3 21.7 24.75 26.525 27.025 4 24.125 31.55 19.975 24.349999999999998 5 25.2 32.625 23.275000000000002 18.9 6 20.05 35.4 23.625 20.925 7 16.950000000000003 19.15 42.3 21.6 8 19.175 22.650000000000002 29.975 28.199999999999996 9 21.4 22.650000000000002 29.2 26.75 10-11 22.6375 32.975 21.75 22.6375 12-13 21.3 26.3625 28.212500000000002 24.125 14-15 21.875 27.025 27.6375 23.4625 16-17 21.775 27.525 26.325 24.375 18-19 22.650000000000002 26.8375 26.525 23.9875 20-21 23.075000000000003 28.025 26.025 22.875 22-23 22.125 27.474999999999998 27.224999999999998 23.175 24-25 22.0125 27.0875 27.4125 23.4875 26-27 22.25 28.212500000000002 26.1625 23.375 28-29 22.4375 27.1375 27.325 23.1 30-31 22.6875 27.575 26.825 22.912499999999998 32-33 21.95 28.9 25.924999999999997 23.225 34-35 22.9875 27.375 26.787499999999998 22.85 36-37 22.412499999999998 27.875 26.325 23.3875 38-39 22.475 28.287499999999998 26.85 22.3875 40-41 22.125 28.125 26.1 23.65 42-43 21.712500000000002 27.6625 27.425 23.200000000000003 44-45 22.1375 28.075 26.5625 23.225 46-47 23.125 26.687499999999996 26.650000000000002 23.5375 48-49 22.8875 27.287499999999998 27.0625 22.7625 50-51 22.875 27.3125 27.037499999999998 22.775000000000002 52-53 22.225 27.224999999999998 27.175 23.375 54-55 22.35 27.712500000000002 26.1625 23.775 56-57 22.3 27.462500000000002 26.937499999999996 23.3 58-59 22.2125 27.150000000000002 27.9375 22.7 60-61 22.875 27.2625 26.6625 23.200000000000003 62-63 21.925 26.5 28.025 23.549999999999997 64-65 23.175 26.9125 27.425 22.4875 66-67 22.25 27.1625 27.437499999999996 23.150000000000002 68-69 22.7375 27.212500000000002 27.437499999999996 22.6125 70-71 22.05 27.6625 26.825 23.4625 72-73 21.95 27.6375 27.3 23.1125 74-75 23.3 27.575 27.287499999999998 21.837500000000002 76-77 22.5125 27.3125 26.9125 23.2625 78-79 22.400000000000002 27.6 27.150000000000002 22.85 80-81 23.674999999999997 27.1 26.9625 22.2625 82-83 22.8875 27.325 26.787499999999998 23.0 84-85 23.0 27.5125 27.1125 22.375 86-87 22.629472104078058 27.708281210908183 27.282962221666253 22.37928446334751 88-89 23.633862698511944 27.210203826434913 26.62248343128673 22.53345004376641 90-91 23.78094523630908 27.094273568392097 26.831707926981746 22.29307326831708 92-93 23.2125 28.3375 26.5 21.95 94-95 23.35 27.575 26.125 22.95 96-97 23.2875 27.2625 26.8625 22.5875 98-99 23.3875 27.787499999999998 26.137500000000003 22.6875 100 22.55 27.950000000000003 26.825 22.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 4.0 28 8.0 29 10.0 30 12.5 31 18.5 32 24.5 33 33.0 34 37.0 35 42.0 36 56.5 37 77.5 38 103.0 39 122.5 40 156.0 41 184.5 42 204.5 43 230.5 44 251.0 45 254.5 46 255.0 47 241.5 48 250.0 49 245.0 50 196.0 51 171.5 52 145.5 53 123.0 54 114.0 55 98.0 56 76.5 57 63.0 58 51.5 59 41.0 60 34.5 61 25.5 62 14.5 63 8.5 64 3.5 65 2.0 66 1.5 67 0.5 68 1.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.075 88-89 0.0375 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31628260319069 98.05 2 0.5571030640668524 1.0999999999999999 3 0.07596859964547988 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05064573309698658 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 15 0.375 TruSeq Adapter, Index 13 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTA 10 0.25 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.25 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10-11 0.25 0.0 0.0 0.0 0.0 12-13 0.25 0.0 0.0 0.0 0.0 14-15 0.25 0.0 0.0 0.0 0.0 16-17 0.25 0.0 0.0 0.0 0.0 18-19 0.25 0.0 0.0 0.0 0.0 20-21 0.25 0.0 0.0 0.0 0.0 22-23 0.25 0.0 0.0 0.0 0.0 24-25 0.25 0.0 0.0 0.0 0.0 26-27 0.25 0.0 0.0 0.0 0.0 28-29 0.25 0.0 0.0 0.0 0.0 30-31 0.25 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.25 0.0 0.0 0.0 0.0 42-43 0.25 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.25 0.0 0.0 0.0 0.0 58-59 0.275 0.0 0.0 0.0 0.0 60-61 0.3 0.0 0.0 0.0 0.0 62-63 0.325 0.0 0.0 0.0 0.0 64-65 0.3375 0.0 0.0 0.0 0.0 66-67 0.375 0.0 0.0 0.0 0.0 68-69 0.4125 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.5625 0.0 0.0 0.0 0.0 74-75 0.675 0.0 0.0 0.0 0.0 76-77 0.725 0.0 0.0 0.0 0.0 78-79 0.7625 0.0 0.0 0.0 0.0 80-81 0.825 0.0 0.0 0.0 0.0 82-83 1.025 0.0 0.0 0.0 0.0 84-85 1.3875000000000002 0.0 0.0 0.0 0.0 86-87 1.625 0.0 0.0 0.0 0.0 88 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642812 spots for SRR3472994.sra Written 642812 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra Read 642802 spots for SRR3472994.sra Written 642802 spots for SRR3472994.sra SRR ids: ['SRR3472994.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fs8dthsp SRR3472994.sra spots: 12856050 blocks: [[1, 642802], [642803, 1285604], [1285605, 1928406], [1928407, 2571208], [2571209, 3214010], [3214011, 3856812], [3856813, 4499614], [4499615, 5142416], [5142417, 5785218], [5785219, 6428020], [6428021, 7070822], [7070823, 7713624], [7713625, 8356426], [8356427, 8999228], [8999229, 9642030], [9642031, 10284832], [10284833, 10927634], [10927635, 11570436], [11570437, 12213238], [12213239, 12856050]] SRR3472994 file size 3510753 SRR3472994 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3472994 SRR3472994_1.fastq Input file: SRR3472994_1.fastq trimmed: SRR3472994-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 23:44:01 2025 >> started Thu Feb 13 23:44:07 2025 >> done (6.385s) 12856050 reads processed; of these: 5268 ( 0.04%) short reads filtered out after trimming by size control 76823 ( 0.60%) empty reads filtered out after trimming by size control 12773959 (99.36%) reads available; of these: 756746 ( 5.92%) trimmed reads available after processing 12017213 (94.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 582 0.00% 19 634 0.00% 20 844 0.01% 21 812 0.01% 22 927 0.01% 23 1122 0.01% 24 1322 0.01% 25 1608 0.01% 26 1675 0.01% 27 1603 0.01% 28 1650 0.01% 29 1870 0.01% 30 1931 0.02% 31 1853 0.01% 32 1996 0.02% 33 2024 0.02% 34 2093 0.02% 35 2200 0.02% 36 2463 0.02% 37 2576 0.02% 38 2595 0.02% 39 2709 0.02% 40 3060 0.02% 41 3124 0.02% 42 3281 0.03% 43 3319 0.03% 44 3598 0.03% 45 3676 0.03% 46 4007 0.03% 47 4041 0.03% 48 4125 0.03% 49 4602 0.04% 50 4618 0.04% 51 4821 0.04% 52 4819 0.04% 53 4996 0.04% 54 5185 0.04% 55 5048 0.04% 56 5247 0.04% 57 5377 0.04% 58 5653 0.04% 59 5723 0.04% 60 6012 0.05% 61 6500 0.05% 62 6465 0.05% 63 6759 0.05% 64 7092 0.06% 65 7292 0.06% 66 7364 0.06% 67 7805 0.06% 68 8321 0.07% 69 6440 0.05% 70 6661 0.05% 71 6708 0.05% 72 6888 0.05% 73 7206 0.06% 74 7518 0.06% 75 7435 0.06% 76 7468 0.06% 77 7914 0.06% 78 8261 0.06% 79 8535 0.07% 80 9003 0.07% 81 9911 0.08% 82 10134 0.08% 83 10893 0.09% 84 11551 0.09% 85 12556 0.10% 86 13399 0.10% 87 14593 0.11% 88 16203 0.13% 89 17516 0.14% 90 19673 0.15% 91 21987 0.17% 92 25514 0.20% 93 29574 0.23% 94 34806 0.27% 95 40282 0.32% 96 46571 0.36% 97 50282 0.39% 98 49372 0.39% 99 42873 0.34% 100 12017213 94.08% 12773959 reads passed initial QC criterion=sequence-density sequence-density=1.54 sequence-density-rank=1 fanout-score=58.31 fanout-score-rank=1 prefix-density=2.13 prefix-fanout=42.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=1.54 sequence-density-rank=1 fanout-score=58.31 fanout-score-rank=1 prefix-density=2.13 prefix-fanout=42.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Started job on | Feb 13 23:44:22 Started mapping on | Feb 13 23:44:22 Finished on | Feb 13 23:44:38 Mapping speed, Million of reads per hour | 2874.14 Number of input reads | 12773959 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 11960374 Uniquely mapped reads % | 93.63% Average mapped length | 98.29 Number of splices: Total | 3440383 Number of splices: Annotated (sjdb) | 3399623 Number of splices: GT/AG | 3367942 Number of splices: GC/AG | 60405 Number of splices: AT/AC | 3178 Number of splices: Non-canonical | 8858 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 1.59 Insertion rate per base | 0.01% Insertion average length | 1.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 595652 % of reads mapped to multiple loci | 4.66% Number of reads mapped to too many loci | 100094 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 217933 217933 217933 N_multimapping 595652 595652 595652 N_noFeature 189251 6127293 5955086 N_ambiguous 143530 38073 38292 UnstrandedReadsAssigned:11627593 PositiveStrandReadsAssigned:5795008 NegativeStrandReadsAssigned:5966996 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3472994 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3472994-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,773,959 reads, 12,238,026 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR3472994.ke.tsv 34699 SRR3472994.se.tsv 87100 total ==> SRR3472994.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 355 17.5271 Potri.005G024800.1.v4.1 1035 936 69.0145 6.9859 Potri.004G059700.1.v4.1 961 862 15 1.6487 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 222.158 7.401 Potri.016G087400.1.v4.1 270 171 362 200.572 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 3 0.169794 Potri.012G127500.1.v4.1 977 878 953 102.839 ==> SRR3472994.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 102 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3472994 completed mapping pipeline successfully