Starting /dee2/code/volunteer_pipeline.sh SRR3472995 current disk space = 3089325223936 free memory = 1412952984 SRR3472995 SRAfilesize a3603f5f28804aa4b56686e79216b18f SRR3472995.sra SRR3472995.sra file validated SRR3472995 is single end SRR3472995 is conventional basespace SRR3472995 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3472995_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5855 34.0 31.0 34.0 30.0 34.0 2 32.16375 34.0 31.0 34.0 30.0 34.0 3 32.58625 34.0 31.0 34.0 31.0 34.0 4 36.14625 37.0 35.0 37.0 35.0 37.0 5 36.17925 37.0 35.0 37.0 35.0 37.0 6 36.02575 37.0 35.0 37.0 35.0 37.0 7 36.00925 37.0 35.0 37.0 35.0 37.0 8 35.9275 37.0 35.0 37.0 35.0 37.0 9 37.737 39.0 38.0 39.0 35.0 39.0 10-11 37.740375 39.0 38.0 39.0 35.0 39.0 12-13 37.61 39.0 37.5 39.0 35.0 39.0 14-15 39.00375 40.5 38.0 41.0 36.0 41.0 16-17 39.126125 41.0 39.0 41.0 36.0 41.0 18-19 39.084 41.0 38.5 41.0 36.0 41.0 20-21 39.025375 40.5 39.0 41.0 35.5 41.0 22-23 39.073375 41.0 39.0 41.0 36.0 41.0 24-25 38.983875 40.5 38.5 41.0 35.5 41.0 26-27 38.693749999999994 40.0 38.0 41.0 34.5 41.0 28-29 38.89275 40.0 38.5 41.0 35.0 41.0 30-31 38.8155 40.0 38.0 41.0 35.0 41.0 32-33 38.67775 40.0 38.0 41.0 34.0 41.0 34-35 38.71425000000001 40.0 38.0 41.0 35.0 41.0 36-37 38.691375 40.0 38.0 41.0 34.5 41.0 38-39 38.56725 40.0 38.0 41.0 34.0 41.0 40-41 38.50075 40.0 38.0 41.0 34.0 41.0 42-43 38.50775 40.0 38.0 41.0 34.0 41.0 44-45 38.315749999999994 40.0 38.0 41.0 33.0 41.0 46-47 38.295125 40.0 38.0 41.0 34.0 41.0 48-49 38.14175 40.0 38.0 41.0 33.0 41.0 50-51 37.975875 40.0 37.5 41.0 33.0 41.0 52-53 37.823375 40.0 37.0 41.0 33.0 41.0 54-55 37.7365 40.0 37.0 41.0 33.0 41.0 56-57 37.502875 39.0 36.5 41.0 32.5 41.0 58-59 37.365875 39.0 36.0 41.0 32.0 41.0 60-61 37.075500000000005 39.0 36.0 40.0 31.5 41.0 62-63 36.750249999999994 38.5 35.0 40.0 31.0 41.0 64-65 36.31125 38.0 35.0 40.0 31.0 41.0 66-67 36.257875 38.0 35.0 40.0 31.0 41.0 68-69 36.210750000000004 37.0 35.0 39.5 31.0 41.0 70-71 35.868125 37.0 35.0 39.0 31.0 41.0 72-73 35.42175 36.0 35.0 39.0 31.0 40.5 74-75 35.03875 36.0 34.0 38.0 30.5 39.0 76-77 34.765625 35.0 34.0 37.0 31.0 39.0 78-79 34.41325 35.0 34.0 37.0 31.0 39.0 80-81 34.098375000000004 35.0 34.0 36.0 30.0 37.0 82-83 33.821625 35.0 34.0 36.0 30.0 37.0 84-85 33.551874999999995 35.0 34.0 35.5 30.0 37.0 86-87 33.378125 35.0 34.0 35.0 30.0 36.0 88-89 33.239125 35.0 34.0 35.0 29.5 36.0 90-91 33.134625 35.0 34.0 35.0 30.0 36.0 92-93 33.036375 35.0 34.0 35.0 30.0 36.0 94-95 32.90025 35.0 34.0 35.0 29.5 35.0 96-97 32.6845 35.0 34.0 35.0 29.5 35.0 98-99 32.422250000000005 35.0 33.5 35.0 29.0 35.0 100 31.686 34.0 32.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 1.0 9 1.0 10 2.0 11 1.0 12 2.0 13 3.0 14 2.0 15 5.0 16 4.0 17 2.0 18 5.0 19 7.0 20 5.0 21 6.0 22 10.0 23 8.0 24 14.0 25 11.0 26 30.0 27 28.0 28 27.0 29 57.0 30 45.0 31 57.0 32 81.0 33 112.0 34 167.0 35 267.0 36 467.0 37 929.0 38 1379.0 39 262.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.17864476386037 13.16735112936345 16.529774127310063 46.12422997946612 2 18.575 22.3 37.325 21.8 3 21.925 26.625 26.325 25.124999999999996 4 24.25 32.25 19.75 23.75 5 24.5 33.7 22.725 19.075 6 18.85 37.475 23.875 19.8 7 16.575 17.5 45.15 20.775 8 18.95 21.975 30.25 28.825 9 20.875 22.35 31.424999999999997 25.35 10-11 22.8 32.925 22.2125 22.0625 12-13 21.3 25.912499999999998 29.4125 23.375 14-15 21.1875 28.000000000000004 27.712500000000002 23.1 16-17 21.95 28.749999999999996 26.9125 22.3875 18-19 21.3 28.287499999999998 27.625 22.787499999999998 20-21 22.675 27.437499999999996 27.037499999999998 22.85 22-23 21.712500000000002 27.275 27.35 23.6625 24-25 21.587500000000002 27.775 27.650000000000002 22.9875 26-27 22.225 27.575 26.700000000000003 23.5 28-29 21.5625 27.725 26.875 23.8375 30-31 21.8875 28.1875 27.450000000000003 22.475 32-33 22.650000000000002 28.299999999999997 26.6 22.45 34-35 22.1875 27.1 27.3375 23.375 36-37 22.6875 26.5 28.349999999999998 22.4625 38-39 22.475 27.025 26.5 24.0 40-41 21.912499999999998 28.262500000000003 26.7125 23.1125 42-43 21.85 27.8875 26.637499999999996 23.625 44-45 22.7 28.1875 27.0875 22.025 46-47 22.475 28.549999999999997 26.5 22.475 48-49 22.775000000000002 27.700000000000003 26.775 22.75 50-51 22.4375 28.449999999999996 26.775 22.3375 52-53 23.2625 28.199999999999996 25.8 22.7375 54-55 22.925 27.5875 26.237500000000004 23.25 56-57 22.35 27.962500000000002 27.037499999999998 22.650000000000002 58-59 21.775 27.125 28.65 22.45 60-61 21.9375 27.6125 27.950000000000003 22.5 62-63 22.125 27.125 27.750000000000004 23.0 64-65 23.0125 27.200000000000003 27.9125 21.875 66-67 22.112499999999997 28.000000000000004 26.900000000000002 22.9875 68-69 22.925 28.1625 27.0 21.912499999999998 70-71 22.2 28.3125 26.5375 22.95 72-73 21.9625 27.800000000000004 27.200000000000003 23.0375 74-75 21.525 27.925 27.6 22.95 76-77 22.925 27.6125 26.4625 23.0 78-79 22.35 28.275 27.450000000000003 21.925 80-81 22.9375 27.450000000000003 27.1625 22.45 82-83 22.675 27.400000000000002 26.8375 23.0875 84-85 23.275000000000002 27.987499999999997 26.5125 22.225 86-87 21.9375 27.725 27.987499999999997 22.35 88-89 22.875 27.625 27.224999999999998 22.275 90-91 23.7 26.4125 27.224999999999998 22.662499999999998 92-93 22.85 27.425 26.4625 23.2625 94-95 22.95 27.675 26.787499999999998 22.5875 96-97 23.175 28.125 26.637499999999996 22.0625 98-99 23.6875 27.3375 27.025 21.95 100 22.325 29.75 25.724999999999998 22.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.0 25 0.5 26 1.0 27 4.5 28 7.0 29 9.0 30 11.5 31 16.0 32 26.0 33 39.0 34 45.5 35 56.0 36 68.0 37 81.5 38 113.5 39 143.0 40 166.0 41 190.5 42 214.5 43 222.5 44 246.5 45 270.0 46 271.0 47 263.0 48 237.0 49 217.0 50 202.5 51 179.5 52 140.5 53 115.5 54 103.5 55 75.5 56 57.0 57 53.5 58 43.0 59 31.5 60 22.0 61 16.0 62 12.0 63 8.5 64 5.5 65 3.5 66 2.0 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.975 0.0 0.0 0.0 0.0 86-87 1.225 0.0 0.0 0.0 0.0 88 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747316 spots for SRR3472995.sra Written 747316 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra Read 747307 spots for SRR3472995.sra Written 747307 spots for SRR3472995.sra SRR ids: ['SRR3472995.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x8qpp0fe SRR3472995.sra spots: 14946149 blocks: [[1, 747307], [747308, 1494614], [1494615, 2241921], [2241922, 2989228], [2989229, 3736535], [3736536, 4483842], [4483843, 5231149], [5231150, 5978456], [5978457, 6725763], [6725764, 7473070], [7473071, 8220377], [8220378, 8967684], [8967685, 9714991], [9714992, 10462298], [10462299, 11209605], [11209606, 11956912], [11956913, 12704219], [12704220, 13451526], [13451527, 14198833], [14198834, 14946149]] SRR3472995 file size 4083279 SRR3472995 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3472995 SRR3472995_1.fastq Input file: SRR3472995_1.fastq trimmed: SRR3472995-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 22:54:54 2025 >> started Thu Feb 13 22:55:07 2025 >> done (12.396s) 14946149 reads processed; of these: 7195 ( 0.05%) short reads filtered out after trimming by size control 30155 ( 0.20%) empty reads filtered out after trimming by size control 14908799 (99.75%) reads available; of these: 915696 ( 6.14%) trimmed reads available after processing 13993103 (93.86%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 745 0.00% 19 838 0.01% 20 999 0.01% 21 1075 0.01% 22 1242 0.01% 23 1471 0.01% 24 1662 0.01% 25 2146 0.01% 26 2073 0.01% 27 2072 0.01% 28 2160 0.01% 29 2426 0.02% 30 2552 0.02% 31 2423 0.02% 32 2473 0.02% 33 2566 0.02% 34 2655 0.02% 35 2923 0.02% 36 3078 0.02% 37 3257 0.02% 38 3406 0.02% 39 3476 0.02% 40 3744 0.03% 41 3872 0.03% 42 4102 0.03% 43 4226 0.03% 44 4582 0.03% 45 4787 0.03% 46 5200 0.03% 47 5104 0.03% 48 5403 0.04% 49 5725 0.04% 50 5732 0.04% 51 5982 0.04% 52 6160 0.04% 53 6278 0.04% 54 6303 0.04% 55 6305 0.04% 56 6313 0.04% 57 6539 0.04% 58 6727 0.05% 59 6853 0.05% 60 6966 0.05% 61 7464 0.05% 62 7508 0.05% 63 7492 0.05% 64 7701 0.05% 65 7936 0.05% 66 7662 0.05% 67 8532 0.06% 68 8996 0.06% 69 7795 0.05% 70 8259 0.06% 71 8149 0.05% 72 8365 0.06% 73 8787 0.06% 74 8927 0.06% 75 9027 0.06% 76 9204 0.06% 77 9765 0.07% 78 10216 0.07% 79 10685 0.07% 80 11308 0.08% 81 12136 0.08% 82 12314 0.08% 83 13423 0.09% 84 14059 0.09% 85 15125 0.10% 86 16386 0.11% 87 17717 0.12% 88 19800 0.13% 89 21531 0.14% 90 23819 0.16% 91 26531 0.18% 92 31040 0.21% 93 35628 0.24% 94 41950 0.28% 95 48903 0.33% 96 55865 0.37% 97 60190 0.40% 98 59321 0.40% 99 51559 0.35% 100 13993103 93.86% 14908799 reads passed initial QC criterion=sequence-density sequence-density=1.12 sequence-density-rank=1 fanout-score=56.90 fanout-score-rank=1 prefix-density=1.60 prefix-fanout=39.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGC criterion=fanout-score sequence-density=1.12 sequence-density-rank=1 fanout-score=56.90 fanout-score-rank=1 prefix-density=1.60 prefix-fanout=39.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGC Started job on | Feb 13 22:55:29 Started mapping on | Feb 13 22:55:30 Finished on | Feb 13 22:55:55 Mapping speed, Million of reads per hour | 2146.87 Number of input reads | 14908799 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 14059019 Uniquely mapped reads % | 94.30% Average mapped length | 98.34 Number of splices: Total | 4144344 Number of splices: Annotated (sjdb) | 4089716 Number of splices: GT/AG | 4056839 Number of splices: GC/AG | 71879 Number of splices: AT/AC | 3305 Number of splices: Non-canonical | 12321 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 1.52 Insertion rate per base | 0.01% Insertion average length | 1.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 648866 % of reads mapped to multiple loci | 4.35% Number of reads mapped to too many loci | 78628 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.82% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 200914 200914 200914 N_multimapping 648866 648866 648866 N_noFeature 292213 7249662 7026756 N_ambiguous 158677 41486 42502 UnstrandedReadsAssigned:13608129 PositiveStrandReadsAssigned:6767871 NegativeStrandReadsAssigned:6989761 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3472995 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3472995-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,908,799 reads, 14,218,259 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52401 SRR3472995.ke.tsv 34699 SRR3472995.se.tsv 87100 total ==> SRR3472995.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 242 10.5903 Potri.005G024800.1.v4.1 1035 936 72 6.45988 Potri.004G059700.1.v4.1 961 862 10 0.974227 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 249.313 7.36177 Potri.016G087400.1.v4.1 270 171 337.526 165.76 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.100333 Potri.012G127500.1.v4.1 977 878 1455 139.167 ==> SRR3472995.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 143 Potri.001G212900.v4.1 151 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 145 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3472995 completed mapping pipeline successfully