Starting /dee2/code/volunteer_pipeline.sh SRR3472996 current disk space = 3089348648960 free memory = 1413646996 SRR3472996 SRAfilesize 90a1e9a03970361db09f88510b0a766d SRR3472996.sra SRR3472996.sra file validated SRR3472996 is single end SRR3472996 is conventional basespace SRR3472996 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3472996_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.59925 34.0 31.0 34.0 30.0 34.0 2 32.2345 34.0 31.0 34.0 30.0 34.0 3 32.66375 34.0 31.0 34.0 31.0 34.0 4 36.212 37.0 35.0 37.0 35.0 37.0 5 36.2315 37.0 37.0 37.0 35.0 37.0 6 36.20275 37.0 37.0 37.0 35.0 37.0 7 36.08675 37.0 36.0 37.0 35.0 37.0 8 36.078 37.0 36.0 37.0 35.0 37.0 9 37.8575 39.0 38.0 39.0 35.0 39.0 10-11 37.8825 39.0 38.0 39.0 35.0 39.0 12-13 37.736125 39.0 38.0 39.0 35.0 39.0 14-15 39.215375 41.0 39.0 41.0 36.0 41.0 16-17 39.179500000000004 41.0 39.0 41.0 36.0 41.0 18-19 39.173 41.0 39.0 41.0 36.0 41.0 20-21 39.157875000000004 41.0 39.0 41.0 36.0 41.0 22-23 39.17075 41.0 39.0 41.0 36.0 41.0 24-25 39.170249999999996 41.0 39.0 41.0 36.0 41.0 26-27 38.9155 40.5 38.5 41.0 35.0 41.0 28-29 39.035875000000004 40.0 39.0 41.0 36.0 41.0 30-31 39.026624999999996 40.5 39.0 41.0 36.0 41.0 32-33 38.8525 40.0 38.0 41.0 35.0 41.0 34-35 38.893875 40.0 38.0 41.0 35.0 41.0 36-37 38.847624999999994 40.0 38.0 41.0 35.0 41.0 38-39 38.686375 40.0 38.0 41.0 34.5 41.0 40-41 38.709625 40.0 38.0 41.0 34.5 41.0 42-43 38.718375 40.0 38.0 41.0 35.0 41.0 44-45 38.532624999999996 40.0 38.0 41.0 34.5 41.0 46-47 38.48075 40.0 38.0 41.0 34.0 41.0 48-49 38.358 40.0 38.0 41.0 33.5 41.0 50-51 38.247625 40.0 38.0 41.0 33.5 41.0 52-53 38.051375 40.0 37.0 41.0 33.0 41.0 54-55 37.925 40.0 37.0 41.0 33.0 41.0 56-57 37.75875 39.5 37.0 41.0 33.0 41.0 58-59 37.5775 39.0 36.5 41.0 33.0 41.0 60-61 37.336 39.0 36.0 41.0 32.5 41.0 62-63 36.991 39.0 35.5 40.5 32.0 41.0 64-65 36.55775 38.0 35.0 40.0 31.0 41.0 66-67 36.50725 38.0 35.0 40.0 31.5 41.0 68-69 36.4095 37.0 35.0 40.0 32.0 41.0 70-71 36.031625000000005 37.0 35.0 39.0 31.0 41.0 72-73 35.693125 36.0 35.0 39.0 31.5 40.5 74-75 35.187 36.0 35.0 38.0 31.0 39.5 76-77 34.838125000000005 35.0 35.0 37.0 31.0 39.0 78-79 34.542 35.0 34.5 37.0 31.0 39.0 80-81 34.196250000000006 35.0 34.0 36.0 31.0 37.5 82-83 33.879875 35.0 34.0 36.0 30.0 37.0 84-85 33.6545 35.0 34.0 36.0 30.0 37.0 86-87 33.44325 35.0 34.0 35.0 30.0 36.0 88-89 33.334999999999994 35.0 34.0 35.0 30.0 36.0 90-91 33.217 35.0 34.0 35.0 30.0 36.0 92-93 33.123125 35.0 34.0 35.0 30.0 36.0 94-95 32.99125 35.0 34.0 35.0 30.0 35.0 96-97 32.8695 35.0 34.0 35.0 29.5 35.0 98-99 32.668 35.0 34.0 35.0 29.5 35.0 100 32.017 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 1.0 9 4.0 10 2.0 11 3.0 12 2.0 13 0.0 14 2.0 15 1.0 16 3.0 17 6.0 18 7.0 19 2.0 20 6.0 21 4.0 22 8.0 23 5.0 24 17.0 25 13.0 26 19.0 27 17.0 28 25.0 29 39.0 30 56.0 31 59.0 32 88.0 33 105.0 34 145.0 35 222.0 36 442.0 37 988.0 38 1416.0 39 291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.98506309554468 13.829513262941026 15.529229976822045 44.65619366469225 2 18.8 23.0 36.375 21.825 3 20.200000000000003 25.15 27.500000000000004 27.150000000000002 4 23.175 30.725 21.349999999999998 24.75 5 24.925 34.825 21.025 19.225 6 20.125 36.6 23.3 19.975 7 16.650000000000002 18.6 42.875 21.875 8 19.3 22.625 28.249999999999996 29.825000000000003 9 20.349999999999998 23.1 29.95 26.6 10-11 22.475 32.9625 22.6375 21.925 12-13 20.5875 26.387500000000003 29.7125 23.3125 14-15 22.0625 27.2625 28.025 22.650000000000002 16-17 22.9625 26.825 27.037499999999998 23.175 18-19 22.237499999999997 27.187499999999996 27.400000000000002 23.175 20-21 22.537499999999998 27.987499999999997 26.5125 22.9625 22-23 21.825 27.375 27.975 22.825 24-25 20.7875 28.625 27.3875 23.200000000000003 26-27 22.0875 27.5875 27.6375 22.6875 28-29 22.3 27.35 27.450000000000003 22.900000000000002 30-31 21.65 27.437499999999996 27.712500000000002 23.200000000000003 32-33 22.375 27.537499999999998 27.0 23.0875 34-35 22.6875 27.462500000000002 27.3625 22.4875 36-37 21.6875 28.4125 26.8 23.1 38-39 22.45 27.925 26.337500000000002 23.2875 40-41 22.05 28.287499999999998 26.8375 22.825 42-43 21.0125 27.725 27.675 23.5875 44-45 22.3625 27.037499999999998 27.6875 22.912499999999998 46-47 22.662499999999998 27.212500000000002 27.5875 22.537499999999998 48-49 22.25 27.962500000000002 26.887499999999996 22.900000000000002 50-51 22.825 27.8875 26.5875 22.7 52-53 22.3625 27.1375 27.400000000000002 23.1 54-55 21.712500000000002 28.487499999999997 27.275 22.525000000000002 56-57 23.05 27.8625 26.375 22.7125 58-59 21.8 27.487499999999997 27.474999999999998 23.2375 60-61 22.1 27.6 27.462500000000002 22.8375 62-63 22.975 27.4125 28.225 21.3875 64-65 22.625 26.737499999999997 26.937499999999996 23.7 66-67 22.7125 27.200000000000003 27.187499999999996 22.900000000000002 68-69 21.95 28.000000000000004 26.424999999999997 23.625 70-71 22.8375 27.250000000000004 27.575 22.3375 72-73 21.8125 28.6875 26.75 22.75 74-75 22.5875 26.9125 27.2625 23.2375 76-77 22.400000000000002 27.787499999999998 27.325 22.4875 78-79 23.1125 27.537499999999998 26.200000000000003 23.150000000000002 80-81 21.975 27.875 27.5875 22.5625 82-83 22.825 27.925 26.6125 22.6375 84-85 22.977872234029252 27.403425428178522 27.55344418052256 22.06525815726966 86-87 23.332916301764044 26.99862379582134 27.298886525709996 22.369573376704615 88-89 22.04576716268601 26.835063148680753 28.93585094410404 22.1833187445292 90-91 22.268067016754188 28.40710177544386 26.944236059014752 22.380595148787197 92-93 23.1375 28.1125 26.674999999999997 22.075 94-95 22.8625 27.775 26.137500000000003 23.225 96-97 22.225 27.6375 27.4125 22.725 98-99 23.052881610201275 28.378547318414803 26.015751968996128 22.552819102387797 100 22.7 27.224999999999998 26.375 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 0.5 26 1.0 27 3.5 28 4.5 29 6.0 30 10.0 31 12.5 32 17.0 33 32.5 34 46.0 35 55.5 36 68.0 37 88.5 38 109.0 39 138.5 40 169.5 41 184.0 42 211.5 43 246.5 44 264.0 45 259.5 46 251.0 47 258.5 48 260.5 49 239.5 50 209.0 51 167.0 52 133.5 53 131.0 54 111.5 55 72.5 56 56.5 57 46.0 58 34.5 59 29.5 60 25.0 61 18.0 62 11.0 63 5.0 64 2.5 65 2.5 66 1.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0125 86-87 0.08750000000000001 88-89 0.0375 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52128999748048 98.75 2 0.45351473922902497 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02519526329050139 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.0625 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.6000000000000001 0.0 0.0 0.0 0.0 82-83 0.75 0.0 0.0 0.0 0.0 84-85 0.8999999999999999 0.0 0.0 0.0 0.0 86-87 1.1375 0.0 0.0 0.0 0.0 88 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800834 spots for SRR3472996.sra Written 800834 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra Read 800829 spots for SRR3472996.sra Written 800829 spots for SRR3472996.sra SRR ids: ['SRR3472996.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_idol37hr SRR3472996.sra spots: 16016585 blocks: [[1, 800829], [800830, 1601658], [1601659, 2402487], [2402488, 3203316], [3203317, 4004145], [4004146, 4804974], [4804975, 5605803], [5605804, 6406632], [6406633, 7207461], [7207462, 8008290], [8008291, 8809119], [8809120, 9609948], [9609949, 10410777], [10410778, 11211606], [11211607, 12012435], [12012436, 12813264], [12813265, 13614093], [13614094, 14414922], [14414923, 15215751], [15215752, 16016585]] SRR3472996 file size 4376495 SRR3472996 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3472996 SRR3472996_1.fastq Input file: SRR3472996_1.fastq trimmed: SRR3472996-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 23:03:59 2025 >> started Thu Feb 13 23:04:06 2025 >> done (7.941s) 16016585 reads processed; of these: 7522 ( 0.05%) short reads filtered out after trimming by size control 66870 ( 0.42%) empty reads filtered out after trimming by size control 15942193 (99.54%) reads available; of these: 937755 ( 5.88%) trimmed reads available after processing 15004438 (94.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 752 0.00% 19 832 0.01% 20 956 0.01% 21 1138 0.01% 22 1240 0.01% 23 1462 0.01% 24 1694 0.01% 25 2153 0.01% 26 2060 0.01% 27 2043 0.01% 28 2152 0.01% 29 2514 0.02% 30 2544 0.02% 31 2381 0.01% 32 2647 0.02% 33 2647 0.02% 34 2695 0.02% 35 2893 0.02% 36 3188 0.02% 37 3255 0.02% 38 3484 0.02% 39 3589 0.02% 40 4082 0.03% 41 4041 0.03% 42 4187 0.03% 43 4419 0.03% 44 4576 0.03% 45 4851 0.03% 46 4926 0.03% 47 5165 0.03% 48 5437 0.03% 49 5759 0.04% 50 6005 0.04% 51 6008 0.04% 52 6231 0.04% 53 6358 0.04% 54 6362 0.04% 55 6419 0.04% 56 6485 0.04% 57 6473 0.04% 58 6714 0.04% 59 7023 0.04% 60 7092 0.04% 61 7622 0.05% 62 7516 0.05% 63 7807 0.05% 64 8251 0.05% 65 8358 0.05% 66 8047 0.05% 67 8607 0.05% 68 9137 0.06% 69 7913 0.05% 70 8282 0.05% 71 8302 0.05% 72 8945 0.06% 73 9394 0.06% 74 9456 0.06% 75 9201 0.06% 76 9256 0.06% 77 9845 0.06% 78 10241 0.06% 79 10717 0.07% 80 11453 0.07% 81 12323 0.08% 82 12722 0.08% 83 13516 0.08% 84 14297 0.09% 85 15681 0.10% 86 16581 0.10% 87 18161 0.11% 88 20007 0.13% 89 21820 0.14% 90 24430 0.15% 91 27294 0.17% 92 31477 0.20% 93 36547 0.23% 94 42971 0.27% 95 50139 0.31% 96 57372 0.36% 97 61877 0.39% 98 61192 0.38% 99 54066 0.34% 100 15004438 94.12% 15942193 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=62.15 fanout-score-rank=1 prefix-density=1.46 prefix-fanout=42.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=1.00 sequence-density-rank=1 fanout-score=62.15 fanout-score-rank=1 prefix-density=1.46 prefix-fanout=42.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Started job on | Feb 13 23:04:26 Started mapping on | Feb 13 23:04:26 Finished on | Feb 13 23:04:43 Mapping speed, Million of reads per hour | 3375.99 Number of input reads | 15942193 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 14983527 Uniquely mapped reads % | 93.99% Average mapped length | 98.43 Number of splices: Total | 4440443 Number of splices: Annotated (sjdb) | 4387263 Number of splices: GT/AG | 4353996 Number of splices: GC/AG | 71950 Number of splices: AT/AC | 3458 Number of splices: Non-canonical | 11039 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 1.63 Insertion rate per base | 0.01% Insertion average length | 1.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 747844 % of reads mapped to multiple loci | 4.69% Number of reads mapped to too many loci | 62235 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 210822 210822 210822 N_multimapping 747844 747844 747844 N_noFeature 227801 7674318 7464905 N_ambiguous 154855 41367 41487 UnstrandedReadsAssigned:14600871 PositiveStrandReadsAssigned:7267842 NegativeStrandReadsAssigned:7477135 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3472996 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3472996-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,942,193 reads, 15,294,151 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR3472996.ke.tsv 34699 SRR3472996.se.tsv 87100 total ==> SRR3472996.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 269 10.6333 Potri.005G024800.1.v4.1 1035 936 76 6.15927 Potri.004G059700.1.v4.1 961 862 22.5392 1.98345 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 329 8.77522 Potri.016G087400.1.v4.1 270 171 567 251.524 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 4 0.181258 Potri.012G127500.1.v4.1 977 878 1721 148.689 ==> SRR3472996.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 157 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 188 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3472996 completed mapping pipeline successfully