Starting /dee2/code/volunteer_pipeline.sh SRR3472997 current disk space = 3089320558592 free memory = 1436257816 SRR3472997 SRAfilesize a68f2f2e5f076cdbb24c833b9709c989 SRR3472997.sra SRR3472997.sra file validated SRR3472997 is single end SRR3472997 is conventional basespace SRR3472997 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3472997_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.80175 34.0 31.0 34.0 30.0 34.0 2 32.31875 34.0 31.0 34.0 30.0 34.0 3 32.63525 34.0 31.0 34.0 31.0 34.0 4 36.185 37.0 35.0 37.0 35.0 37.0 5 36.20675 37.0 35.0 37.0 35.0 37.0 6 36.11625 37.0 36.0 37.0 35.0 37.0 7 36.0335 37.0 35.0 37.0 35.0 37.0 8 35.998 37.0 35.0 37.0 35.0 37.0 9 37.758 39.0 38.0 39.0 35.0 39.0 10-11 37.79975 39.0 38.0 39.0 35.0 39.0 12-13 37.623625000000004 39.0 37.5 39.0 35.0 39.0 14-15 39.0985 41.0 39.0 41.0 36.0 41.0 16-17 39.10025 41.0 38.5 41.0 36.0 41.0 18-19 39.075874999999996 41.0 38.5 41.0 36.0 41.0 20-21 39.002250000000004 41.0 39.0 41.0 35.5 41.0 22-23 39.088 41.0 39.0 41.0 35.5 41.0 24-25 39.039 41.0 39.0 41.0 35.5 41.0 26-27 38.77025 40.0 38.0 41.0 34.5 41.0 28-29 38.903875 40.0 38.5 41.0 35.0 41.0 30-31 38.807500000000005 40.0 38.0 41.0 34.5 41.0 32-33 38.663624999999996 40.0 38.0 41.0 34.0 41.0 34-35 38.7605 40.0 38.0 41.0 35.0 41.0 36-37 38.671499999999995 40.0 38.0 41.0 34.5 41.0 38-39 38.544 40.0 38.0 41.0 34.0 41.0 40-41 38.539375 40.0 38.0 41.0 34.0 41.0 42-43 38.4675 40.0 38.0 41.0 34.0 41.0 44-45 38.304 40.0 38.0 41.0 33.5 41.0 46-47 38.329750000000004 40.0 38.0 41.0 33.5 41.0 48-49 38.149125 40.0 38.0 41.0 33.5 41.0 50-51 38.108374999999995 40.0 38.0 41.0 33.0 41.0 52-53 37.91075 40.0 37.0 41.0 33.0 41.0 54-55 37.889375 40.0 37.0 41.0 33.0 41.0 56-57 37.5785 39.5 37.0 41.0 32.5 41.0 58-59 37.459374999999994 39.0 36.5 41.0 32.5 41.0 60-61 37.169624999999996 39.0 36.0 41.0 31.5 41.0 62-63 36.894875 39.0 35.5 40.5 31.5 41.0 64-65 36.364125 38.0 35.0 40.0 31.0 41.0 66-67 36.364625000000004 38.0 35.0 40.0 31.0 41.0 68-69 36.29575 37.5 35.0 40.0 31.0 41.0 70-71 35.919375 37.0 35.0 39.0 31.0 41.0 72-73 35.541375 36.5 35.0 39.0 31.0 41.0 74-75 35.06725 36.0 34.5 38.5 30.5 39.5 76-77 34.837 35.5 35.0 37.0 31.0 39.0 78-79 34.421875 35.0 34.0 37.0 30.0 39.0 80-81 34.140874999999994 35.0 34.0 36.5 30.5 38.0 82-83 33.878875 35.0 34.0 36.0 30.0 37.0 84-85 33.65775 35.0 34.0 36.0 30.0 37.0 86-87 33.435874999999996 35.0 34.0 35.0 30.0 36.0 88-89 33.278999999999996 35.0 34.0 35.0 30.0 36.0 90-91 33.195625 35.0 34.0 35.0 30.0 36.0 92-93 33.0555 35.0 34.0 35.0 30.0 36.0 94-95 33.0285 35.0 34.0 35.0 30.0 35.0 96-97 32.812375 35.0 34.0 35.0 29.5 35.0 98-99 32.61125 35.0 34.0 35.0 29.0 35.0 100 31.89225 34.0 32.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 2.0 10 5.0 11 5.0 12 3.0 13 2.0 14 4.0 15 3.0 16 3.0 17 9.0 18 5.0 19 6.0 20 3.0 21 7.0 22 1.0 23 5.0 24 12.0 25 12.0 26 12.0 27 32.0 28 34.0 29 38.0 30 63.0 31 63.0 32 94.0 33 109.0 34 148.0 35 249.0 36 426.0 37 911.0 38 1418.0 39 313.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.955345751467213 13.396274559836693 14.391426384281706 47.25695330441439 2 18.75 23.1 36.675000000000004 21.475 3 19.925 26.575 27.950000000000003 25.55 4 22.475 32.300000000000004 21.975 23.25 5 24.8 34.5 22.3 18.4 6 18.575 37.875 23.3 20.25 7 15.7 18.45 45.025 20.825 8 18.7 24.2 29.65 27.450000000000003 9 19.3 23.425 31.924999999999997 25.35 10-11 21.7 34.575 22.2 21.525 12-13 20.375 27.025 29.4 23.200000000000003 14-15 20.549999999999997 28.15 28.787499999999998 22.5125 16-17 21.8875 27.700000000000003 26.987499999999997 23.425 18-19 21.45 28.749999999999996 27.3625 22.4375 20-21 21.25 28.799999999999997 27.8625 22.0875 22-23 21.4375 30.3 26.174999999999997 22.0875 24-25 20.8125 29.212500000000002 27.3125 22.662499999999998 26-27 21.45 29.45 26.375 22.725 28-29 21.275 28.925 26.8125 22.9875 30-31 21.4875 29.1875 27.575 21.75 32-33 22.075 28.65 26.650000000000002 22.625 34-35 21.637500000000003 28.537499999999998 28.349999999999998 21.475 36-37 21.6125 29.012500000000003 27.437499999999996 21.9375 38-39 22.237499999999997 29.262500000000003 26.6125 21.8875 40-41 20.525 29.612500000000004 27.725 22.1375 42-43 22.4875 27.800000000000004 27.3875 22.325 44-45 20.6375 28.512500000000003 27.950000000000003 22.900000000000002 46-47 20.724999999999998 29.299999999999997 28.275 21.7 48-49 21.4125 28.225 27.425 22.9375 50-51 21.099999999999998 28.825 27.987499999999997 22.0875 52-53 21.6 29.3875 27.6375 21.375 54-55 20.875 29.212500000000002 28.037499999999998 21.875 56-57 21.45 28.9 27.825 21.825 58-59 21.4375 29.375 27.6625 21.525 60-61 21.5 27.975 27.450000000000003 23.075000000000003 62-63 22.775000000000002 26.937499999999996 27.962500000000002 22.325 64-65 22.525000000000002 28.15 27.9375 21.3875 66-67 21.512500000000003 28.1125 28.000000000000004 22.375 68-69 22.2125 28.9875 26.900000000000002 21.9 70-71 21.6875 29.099999999999998 27.037499999999998 22.175 72-73 22.3 28.212500000000002 26.987499999999997 22.5 74-75 21.7375 27.787499999999998 29.1375 21.337500000000002 76-77 21.212500000000002 28.499999999999996 28.499999999999996 21.7875 78-79 21.4375 28.225 27.4125 22.925 80-81 22.037499999999998 28.075 27.5875 22.3 82-83 21.5625 28.787499999999998 28.075 21.575 84-85 21.925 27.6875 28.625 21.762500000000003 86-87 22.448724362181093 27.5887943971986 27.301150575287643 22.661330665332667 88-89 22.13053263315829 28.507126781695426 27.431857964491122 21.930482620655166 90-91 22.1375 28.175 27.1375 22.55 92-93 21.4375 28.199999999999996 28.1375 22.225 94-95 21.375 28.675 27.35 22.6 96-97 22.8625 28.3875 27.187499999999996 21.5625 98-99 22.675 27.775 27.875 21.675 100 22.15 28.225 27.975 21.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 3.0 26 2.5 27 6.0 28 12.5 29 13.0 30 18.0 31 31.0 32 40.0 33 56.5 34 70.5 35 74.0 36 81.5 37 108.0 38 138.5 39 162.5 40 191.0 41 226.5 42 256.5 43 261.0 44 250.5 45 251.0 46 252.0 47 250.5 48 226.0 49 200.5 50 170.0 51 129.0 52 119.0 53 100.5 54 74.5 55 56.0 56 46.5 57 33.5 58 17.0 59 13.0 60 10.5 61 7.0 62 9.0 63 8.5 64 6.0 65 3.5 66 2.0 67 1.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.05 88-89 0.025 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6499999999999999 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.075 0.0 0.0 0.0 0.0 88 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637164 spots for SRR3472997.sra Written 637164 spots for SRR3472997.sra Read 637177 spots for SRR3472997.sra Written 637177 spots for SRR3472997.sra SRR ids: ['SRR3472997.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fsl3uchp SRR3472997.sra spots: 12743293 blocks: [[1, 637164], [637165, 1274328], [1274329, 1911492], [1911493, 2548656], [2548657, 3185820], [3185821, 3822984], [3822985, 4460148], [4460149, 5097312], [5097313, 5734476], [5734477, 6371640], [6371641, 7008804], [7008805, 7645968], [7645969, 8283132], [8283133, 8920296], [8920297, 9557460], [9557461, 10194624], [10194625, 10831788], [10831789, 11468952], [11468953, 12106116], [12106117, 12743293]] SRR3472997 file size 3479864 SRR3472997 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3472997 SRR3472997_1.fastq Input file: SRR3472997_1.fastq trimmed: SRR3472997-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 23:06:42 2025 >> started Thu Feb 13 23:06:48 2025 >> done (6.667s) 12743293 reads processed; of these: 4703 ( 0.04%) short reads filtered out after trimming by size control 21173 ( 0.17%) empty reads filtered out after trimming by size control 12717417 (99.80%) reads available; of these: 743025 ( 5.84%) trimmed reads available after processing 11974392 (94.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 542 0.00% 19 615 0.00% 20 730 0.01% 21 854 0.01% 22 940 0.01% 23 1124 0.01% 24 1311 0.01% 25 1670 0.01% 26 1590 0.01% 27 1707 0.01% 28 1687 0.01% 29 1943 0.02% 30 2093 0.02% 31 1937 0.02% 32 1904 0.01% 33 1894 0.01% 34 2037 0.02% 35 2142 0.02% 36 2288 0.02% 37 2461 0.02% 38 2628 0.02% 39 2626 0.02% 40 3037 0.02% 41 3076 0.02% 42 3121 0.02% 43 3217 0.03% 44 3405 0.03% 45 3631 0.03% 46 3800 0.03% 47 3892 0.03% 48 4057 0.03% 49 4387 0.03% 50 4502 0.04% 51 4646 0.04% 52 4779 0.04% 53 4946 0.04% 54 4904 0.04% 55 5007 0.04% 56 5056 0.04% 57 5202 0.04% 58 5245 0.04% 59 5439 0.04% 60 5281 0.04% 61 5582 0.04% 62 5742 0.05% 63 5882 0.05% 64 5958 0.05% 65 5973 0.05% 66 6199 0.05% 67 6558 0.05% 68 7109 0.06% 69 6110 0.05% 70 6471 0.05% 71 6542 0.05% 72 6843 0.05% 73 6788 0.05% 74 7079 0.06% 75 7167 0.06% 76 7393 0.06% 77 7865 0.06% 78 8178 0.06% 79 8576 0.07% 80 9344 0.07% 81 9804 0.08% 82 10299 0.08% 83 10839 0.09% 84 11744 0.09% 85 12476 0.10% 86 13606 0.11% 87 14502 0.11% 88 16310 0.13% 89 17462 0.14% 90 19546 0.15% 91 22012 0.17% 92 25661 0.20% 93 29752 0.23% 94 34887 0.27% 95 41027 0.32% 96 46349 0.36% 97 50161 0.39% 98 49045 0.39% 99 42831 0.34% 100 11974392 94.16% 12717417 reads passed initial QC criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=61.17 fanout-score-rank=4 prefix-density=1.65 prefix-fanout=42.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=228.67 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=23.5 sequence=CTTCTTCTTCTTG Started job on | Feb 13 23:07:06 Started mapping on | Feb 13 23:07:06 Finished on | Feb 13 23:07:21 Mapping speed, Million of reads per hour | 3052.18 Number of input reads | 12717417 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 12139930 Uniquely mapped reads % | 95.46% Average mapped length | 98.37 Number of splices: Total | 3441498 Number of splices: Annotated (sjdb) | 3383360 Number of splices: GT/AG | 3378400 Number of splices: GC/AG | 50633 Number of splices: AT/AC | 4305 Number of splices: Non-canonical | 8160 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 1.59 Insertion rate per base | 0.01% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323937 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 135088 % of reads mapped to too many loci | 1.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 253550 253550 253550 N_multimapping 323937 323937 323937 N_noFeature 336910 6312411 6100128 N_ambiguous 103627 19343 20263 UnstrandedReadsAssigned:11699393 PositiveStrandReadsAssigned:5808176 NegativeStrandReadsAssigned:6019539 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3472997 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3472997-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,717,417 reads, 11,983,169 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR3472997.ke.tsv 34699 SRR3472997.se.tsv 87100 total ==> SRR3472997.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 384 17.3309 Potri.005G024800.1.v4.1 1035 936 169.009 15.6386 Potri.004G059700.1.v4.1 961 862 25 2.51187 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 422.607 12.8698 Potri.016G087400.1.v4.1 270 171 859.472 435.312 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 23 1.18997 Potri.012G127500.1.v4.1 977 878 24427 2409.57 ==> SRR3472997.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 140 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 364 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3472997 completed mapping pipeline successfully