Starting /dee2/code/volunteer_pipeline.sh SRR3472998 current disk space = 3089321902080 free memory = 1416066016 SRR3472998 SRAfilesize 53d2fbd6a31d437bf7320d68e15b5109 SRR3472998.sra SRR3472998.sra file validated SRR3472998 is single end SRR3472998 is conventional basespace SRR3472998 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3472998_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.78925 34.0 31.0 34.0 30.0 34.0 2 32.29025 34.0 31.0 34.0 30.0 34.0 3 32.6665 34.0 31.0 34.0 31.0 34.0 4 36.16975 37.0 35.0 37.0 35.0 37.0 5 36.21825 37.0 35.0 37.0 35.0 37.0 6 36.15825 37.0 37.0 37.0 35.0 37.0 7 36.108 37.0 36.0 37.0 35.0 37.0 8 36.01575 37.0 36.0 37.0 35.0 37.0 9 37.75125 39.0 38.0 39.0 35.0 39.0 10-11 37.8335 39.0 38.0 39.0 35.0 39.0 12-13 37.691874999999996 39.0 38.0 39.0 35.0 39.0 14-15 39.107875 41.0 39.0 41.0 36.0 41.0 16-17 39.207875 41.0 39.0 41.0 36.0 41.0 18-19 39.12425 41.0 39.0 41.0 36.0 41.0 20-21 39.035875 40.5 39.0 41.0 35.5 41.0 22-23 39.030375 41.0 39.0 41.0 35.5 41.0 24-25 39.045375 41.0 39.0 41.0 35.5 41.0 26-27 38.682125 40.0 38.0 41.0 34.0 41.0 28-29 38.887 40.0 39.0 41.0 35.0 41.0 30-31 38.838750000000005 40.0 38.0 41.0 35.0 41.0 32-33 38.68325 40.0 38.0 41.0 34.0 41.0 34-35 38.759 40.0 38.0 41.0 35.0 41.0 36-37 38.660375 40.0 38.0 41.0 34.5 41.0 38-39 38.465375 40.0 38.0 41.0 34.0 41.0 40-41 38.497125 40.0 38.0 41.0 34.0 41.0 42-43 38.43625 40.0 38.0 41.0 34.0 41.0 44-45 38.322625 40.0 38.0 41.0 33.5 41.0 46-47 38.25025 40.0 38.0 41.0 33.0 41.0 48-49 38.0995 40.0 38.0 41.0 33.0 41.0 50-51 38.012 40.0 38.0 41.0 33.0 41.0 52-53 37.817499999999995 40.0 37.0 41.0 33.0 41.0 54-55 37.7365 40.0 37.0 41.0 33.0 41.0 56-57 37.535125 39.5 37.0 41.0 32.0 41.0 58-59 37.317499999999995 39.0 36.0 41.0 32.0 41.0 60-61 37.06125 39.0 36.0 40.5 31.5 41.0 62-63 36.777375 39.0 35.0 40.0 31.0 41.0 64-65 36.399125 38.0 35.0 40.0 31.0 41.0 66-67 36.385875 38.0 35.0 40.0 31.0 41.0 68-69 36.270125 37.0 35.0 40.0 31.0 41.0 70-71 35.937625 37.0 35.0 39.0 31.0 41.0 72-73 35.613 36.5 35.0 39.0 31.0 41.0 74-75 35.133250000000004 36.0 35.0 38.5 31.0 40.0 76-77 34.849125 35.5 35.0 37.0 31.0 39.0 78-79 34.451 35.0 34.0 37.0 31.0 39.0 80-81 34.107124999999996 35.0 34.0 36.5 30.0 38.0 82-83 33.739625000000004 35.0 34.0 36.0 30.0 37.0 84-85 33.535250000000005 35.0 34.0 36.0 30.0 37.0 86-87 33.340875 35.0 34.0 35.0 30.0 36.5 88-89 33.123625000000004 35.0 34.0 35.0 29.0 36.0 90-91 33.050625 35.0 34.0 35.0 29.5 36.0 92-93 32.88275 35.0 34.0 35.0 29.0 36.0 94-95 32.821375 35.0 34.0 35.0 30.0 35.0 96-97 32.61025 35.0 34.0 35.0 29.5 35.0 98-99 32.421625 35.0 34.0 35.0 29.0 35.0 100 31.68825 35.0 32.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 6.0 10 2.0 11 2.0 12 1.0 13 4.0 14 5.0 15 4.0 16 4.0 17 4.0 18 3.0 19 6.0 20 3.0 21 9.0 22 11.0 23 10.0 24 12.0 25 20.0 26 16.0 27 25.0 28 38.0 29 44.0 30 53.0 31 73.0 32 84.0 33 104.0 34 165.0 35 221.0 36 454.0 37 878.0 38 1404.0 39 332.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.726342710997443 13.19693094629156 13.657289002557546 46.41943734015345 2 18.5 22.7 37.3 21.5 3 20.45 25.674999999999997 27.625 26.25 4 21.825 32.4 21.55 24.224999999999998 5 24.825 34.325 22.85 18.0 6 19.079769942485623 37.80945236309077 23.40585146286572 19.70492623155789 7 16.225 19.3 43.175000000000004 21.3 8 18.525 23.7 30.575000000000003 27.200000000000003 9 20.775 23.325000000000003 31.574999999999996 24.325 10-11 22.75 33.95 22.412499999999998 20.8875 12-13 20.9375 27.725 28.15 23.1875 14-15 20.4125 27.3 29.0875 23.200000000000003 16-17 22.175 28.025 26.950000000000003 22.85 18-19 21.875 28.0875 26.2625 23.775 20-21 22.0 28.199999999999996 26.85 22.95 22-23 22.15 28.15 27.450000000000003 22.25 24-25 22.237499999999997 27.8125 28.287499999999998 21.6625 26-27 20.7375 28.4375 27.2625 23.5625 28-29 21.6 29.175 27.1 22.125 30-31 21.45 28.8625 27.3125 22.375 32-33 21.3625 28.9 27.5125 22.225 34-35 21.0125 29.4125 26.8375 22.7375 36-37 21.6125 27.85 28.1 22.4375 38-39 21.525 28.787499999999998 27.525 22.162499999999998 40-41 21.349999999999998 29.062500000000004 27.1125 22.475 42-43 21.7 28.1375 27.6125 22.55 44-45 22.0 27.8125 27.200000000000003 22.9875 46-47 22.375 27.737499999999997 28.15 21.7375 48-49 22.1375 28.299999999999997 26.6 22.9625 50-51 21.4375 28.575 27.85 22.1375 52-53 21.875 27.8125 27.8375 22.475 54-55 22.35 28.262500000000003 26.85 22.537499999999998 56-57 22.3125 27.8625 27.625 22.2 58-59 21.6 28.525 28.237499999999997 21.637500000000003 60-61 22.2125 27.275 27.8375 22.675 62-63 22.0875 28.6375 27.5625 21.712500000000002 64-65 22.525000000000002 28.449999999999996 27.3375 21.6875 66-67 22.05 27.825 27.6875 22.4375 68-69 22.0875 28.5875 27.5875 21.7375 70-71 21.725 27.950000000000003 27.4125 22.912499999999998 72-73 21.4375 27.35 29.075 22.1375 74-75 21.987499999999997 28.125 27.8375 22.05 76-77 22.5875 27.1125 28.1125 22.1875 78-79 22.0125 27.437499999999996 28.249999999999996 22.3 80-81 22.2625 28.5625 26.825 22.35 82-83 22.3 28.237499999999997 27.3 22.162499999999998 84-85 21.875 27.212500000000002 27.9375 22.975 86-87 21.951219512195124 27.21701063164478 27.892432770481552 22.93933708567855 88-89 22.43060765191298 28.019504876219052 27.28182045511378 22.268067016754188 90-91 22.112499999999997 27.925 27.975 21.987499999999997 92-93 22.5 28.225 27.6875 21.587500000000002 94-95 22.525000000000002 28.287499999999998 27.175 22.0125 96-97 21.975 28.9375 26.775 22.3125 98-99 23.150000000000002 28.6875 26.6625 21.5 100 21.175 27.925 27.3 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 1.0 26 3.0 27 6.5 28 8.0 29 10.0 30 14.0 31 24.0 32 35.0 33 49.0 34 57.5 35 69.0 36 87.5 37 93.5 38 116.5 39 152.5 40 193.0 41 224.0 42 231.0 43 249.5 44 266.0 45 258.0 46 261.5 47 265.0 48 236.5 49 196.5 50 174.5 51 158.5 52 127.0 53 93.5 54 73.5 55 61.5 56 46.5 57 36.5 58 31.0 59 24.5 60 16.0 61 10.0 62 9.0 63 5.5 64 2.0 65 1.5 66 2.0 67 2.5 68 4.0 69 3.0 70 1.0 71 0.5 72 0.5 73 1.0 74 1.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0625 88-89 0.025 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87452948557089 99.5 2 0.10037641154328732 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02509410288582183 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 12 0.3 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra Read 666343 spots for SRR3472998.sra Written 666343 spots for SRR3472998.sra Read 666329 spots for SRR3472998.sra Written 666329 spots for SRR3472998.sra SRR ids: ['SRR3472998.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e3190h1d SRR3472998.sra spots: 13326594 blocks: [[1, 666329], [666330, 1332658], [1332659, 1998987], [1998988, 2665316], [2665317, 3331645], [3331646, 3997974], [3997975, 4664303], [4664304, 5330632], [5330633, 5996961], [5996962, 6663290], [6663291, 7329619], [7329620, 7995948], [7995949, 8662277], [8662278, 9328606], [9328607, 9994935], [9994936, 10661264], [10661265, 11327593], [11327594, 11993922], [11993923, 12660251], [12660252, 13326594]] SRR3472998 file size 3639641 SRR3472998 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3472998 SRR3472998_1.fastq Input file: SRR3472998_1.fastq trimmed: SRR3472998-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 23:07:15 2025 >> started Thu Feb 13 23:07:27 2025 >> done (11.600s) 13326594 reads processed; of these: 5624 ( 0.04%) short reads filtered out after trimming by size control 41680 ( 0.31%) empty reads filtered out after trimming by size control 13279290 (99.65%) reads available; of these: 788674 ( 5.94%) trimmed reads available after processing 12490616 (94.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 665 0.01% 19 699 0.01% 20 879 0.01% 21 934 0.01% 22 1086 0.01% 23 1269 0.01% 24 1468 0.01% 25 1805 0.01% 26 1778 0.01% 27 1863 0.01% 28 1850 0.01% 29 2091 0.02% 30 2256 0.02% 31 2014 0.02% 32 2120 0.02% 33 2169 0.02% 34 2369 0.02% 35 2417 0.02% 36 2554 0.02% 37 2727 0.02% 38 2848 0.02% 39 2961 0.02% 40 3154 0.02% 41 3378 0.03% 42 3394 0.03% 43 3548 0.03% 44 3823 0.03% 45 3992 0.03% 46 4178 0.03% 47 4343 0.03% 48 4506 0.03% 49 4794 0.04% 50 4835 0.04% 51 5086 0.04% 52 5114 0.04% 53 5283 0.04% 54 5100 0.04% 55 5286 0.04% 56 5348 0.04% 57 5628 0.04% 58 5779 0.04% 59 5952 0.04% 60 5916 0.04% 61 6202 0.05% 62 6259 0.05% 63 6388 0.05% 64 6522 0.05% 65 6705 0.05% 66 6792 0.05% 67 7315 0.06% 68 7547 0.06% 69 6618 0.05% 70 6825 0.05% 71 6907 0.05% 72 7463 0.06% 73 7511 0.06% 74 7632 0.06% 75 7516 0.06% 76 7829 0.06% 77 8422 0.06% 78 8813 0.07% 79 9043 0.07% 80 9826 0.07% 81 10352 0.08% 82 10833 0.08% 83 11267 0.08% 84 12420 0.09% 85 13398 0.10% 86 14173 0.11% 87 15735 0.12% 88 17261 0.13% 89 18446 0.14% 90 20529 0.15% 91 23267 0.18% 92 27035 0.20% 93 30991 0.23% 94 36125 0.27% 95 42161 0.32% 96 48438 0.36% 97 52173 0.39% 98 51511 0.39% 99 45165 0.34% 100 12490616 94.06% 13279290 reads passed initial QC criterion=sequence-density sequence-density=1.18 sequence-density-rank=1 fanout-score=61.58 fanout-score-rank=6 prefix-density=1.68 prefix-fanout=43.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=9 fanout-score=213.89 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=22.5 sequence=CTTCTTCTTCTT Started job on | Feb 13 23:07:50 Started mapping on | Feb 13 23:07:50 Finished on | Feb 13 23:08:10 Mapping speed, Million of reads per hour | 2390.27 Number of input reads | 13279290 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 12645677 Uniquely mapped reads % | 95.23% Average mapped length | 98.35 Number of splices: Total | 3813508 Number of splices: Annotated (sjdb) | 3749498 Number of splices: GT/AG | 3748114 Number of splices: GC/AG | 52960 Number of splices: AT/AC | 4622 Number of splices: Non-canonical | 7812 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343704 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 174977 % of reads mapped to too many loci | 1.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.86% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 289909 289909 289909 N_multimapping 343704 343704 343704 N_noFeature 355762 6564135 6375859 N_ambiguous 106793 22565 22994 UnstrandedReadsAssigned:12183122 PositiveStrandReadsAssigned:6058977 NegativeStrandReadsAssigned:6246824 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3472998 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3472998-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,279,290 reads, 12,520,678 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR3472998.ke.tsv 34699 SRR3472998.se.tsv 87100 total ==> SRR3472998.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 490 22.0397 Potri.005G024800.1.v4.1 1035 936 286 26.3739 Potri.004G059700.1.v4.1 961 862 30 3.00398 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 314.457 9.54367 Potri.016G087400.1.v4.1 270 171 528.366 266.7 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 50 2.57809 Potri.012G127500.1.v4.1 977 878 39508 3883.96 ==> SRR3472998.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 227 Potri.001G233950.v4.1 9 Potri.001G122700.v4.1 391 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3472998 completed mapping pipeline successfully