Starting /dee2/code/volunteer_pipeline.sh SRR3472999 current disk space = 3089243525120 free memory = 1577098416 SRR3472999 SRAfilesize 8d133a63cf9646d51998ff48b3f40454 SRR3472999.sra SRR3472999.sra file validated SRR3472999 is single end SRR3472999 is conventional basespace SRR3472999 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3472999_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9335 34.0 31.0 34.0 30.0 34.0 2 32.416 34.0 31.0 34.0 30.0 34.0 3 32.68475 34.0 31.0 34.0 31.0 34.0 4 36.19775 37.0 37.0 37.0 35.0 37.0 5 36.21825 37.0 37.0 37.0 35.0 37.0 6 36.17075 37.0 37.0 37.0 35.0 37.0 7 36.1125 37.0 36.0 37.0 35.0 37.0 8 36.111 37.0 36.0 37.0 35.0 37.0 9 37.89225 39.0 38.0 39.0 35.0 39.0 10-11 37.886125 39.0 38.0 39.0 35.0 39.0 12-13 37.68825 39.0 38.0 39.0 35.0 39.0 14-15 39.164249999999996 41.0 39.0 41.0 36.0 41.0 16-17 39.199 41.0 39.0 41.0 36.0 41.0 18-19 39.134625 41.0 39.0 41.0 36.0 41.0 20-21 39.02775 40.5 39.0 41.0 35.5 41.0 22-23 39.03375 41.0 39.0 41.0 35.5 41.0 24-25 39.066375 41.0 39.0 41.0 35.5 41.0 26-27 38.669 40.0 38.5 41.0 34.5 41.0 28-29 38.881874999999994 40.0 38.0 41.0 35.0 41.0 30-31 38.846375 40.0 38.5 41.0 35.0 41.0 32-33 38.530125 40.0 38.0 41.0 34.0 41.0 34-35 38.652874999999995 40.0 38.0 41.0 34.0 41.0 36-37 38.525375 40.0 38.0 41.0 34.0 41.0 38-39 38.242625000000004 40.0 38.0 41.0 33.5 41.0 40-41 38.25375 40.0 38.0 41.0 34.0 41.0 42-43 38.138875 40.0 37.5 41.0 33.0 41.0 44-45 37.8965 40.0 37.0 41.0 33.0 41.0 46-47 37.850624999999994 40.0 37.0 41.0 33.0 41.0 48-49 37.629125 40.0 36.0 41.0 33.0 41.0 50-51 37.513875 40.0 36.0 41.0 32.5 41.0 52-53 37.179125 39.0 35.0 41.0 31.5 41.0 54-55 37.077625 39.0 35.0 41.0 32.0 41.0 56-57 36.88875 39.0 35.0 40.5 31.0 41.0 58-59 36.574375 38.0 35.0 40.0 31.0 41.0 60-61 36.307249999999996 38.0 35.0 40.0 31.0 41.0 62-63 36.033 37.0 35.0 40.0 31.0 41.0 64-65 35.651125 36.5 34.0 39.5 30.0 41.0 66-67 35.621 36.0 34.5 39.0 30.5 41.0 68-69 35.536125 36.0 35.0 39.0 31.0 41.0 70-71 35.119875 35.5 34.0 39.0 30.0 40.5 72-73 34.784625 35.0 34.0 37.5 30.0 39.5 74-75 34.364875 35.0 34.0 37.0 29.5 39.0 76-77 34.221125 35.0 34.0 36.5 30.0 39.0 78-79 33.917625 35.0 34.0 36.0 30.0 38.0 80-81 33.773375 35.0 34.0 36.0 30.0 37.0 82-83 33.506 35.0 34.0 35.5 29.5 37.0 84-85 33.323499999999996 35.0 34.0 35.0 29.0 36.0 86-87 33.177625 35.0 34.0 35.0 29.0 36.0 88-89 32.934 35.0 34.0 35.0 29.0 36.0 90-91 32.906375 35.0 34.0 35.0 29.0 36.0 92-93 32.829625 35.0 34.0 35.0 29.0 35.0 94-95 32.7335 35.0 34.0 35.0 29.0 35.0 96-97 32.538375 35.0 33.5 35.0 29.0 35.0 98-99 32.295125 35.0 33.0 35.0 29.0 35.0 100 31.527 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 5.0 9 0.0 10 1.0 11 3.0 12 2.0 13 6.0 14 1.0 15 2.0 16 5.0 17 2.0 18 4.0 19 8.0 20 7.0 21 7.0 22 3.0 23 8.0 24 18.0 25 19.0 26 28.0 27 32.0 28 50.0 29 50.0 30 56.0 31 70.0 32 78.0 33 131.0 34 171.0 35 346.0 36 530.0 37 1015.0 38 1124.0 39 217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.872167048637635 12.910618792971734 13.547237076648841 47.66997708174179 2 21.575 20.625 33.85 23.95 3 23.75 24.825 24.175 27.250000000000004 4 25.575 29.175 18.65 26.6 5 27.525 32.475 20.3 19.7 6 20.150000000000002 36.025 22.55 21.275 7 17.825 17.424999999999997 42.25 22.5 8 19.625 22.5 28.675 29.2 9 22.5 21.65 29.799999999999997 26.05 10-11 23.3125 32.5375 20.724999999999998 23.425 12-13 22.3375 24.8125 28.050000000000004 24.8 14-15 22.0 26.487500000000004 27.712500000000002 23.799999999999997 16-17 23.2125 25.937500000000004 26.1 24.75 18-19 23.3125 27.1375 25.5 24.05 20-21 23.2125 27.0 25.825 23.962500000000002 22-23 23.549999999999997 25.85 27.0625 23.5375 24-25 22.675 27.537499999999998 25.95 23.8375 26-27 22.6 27.275 25.825 24.3 28-29 23.4875 26.875 25.7875 23.849999999999998 30-31 22.925 26.0375 26.474999999999998 24.5625 32-33 23.5 27.1625 25.424999999999997 23.9125 34-35 22.95 26.6625 26.325 24.0625 36-37 22.5875 26.4125 26.3625 24.637500000000003 38-39 24.1375 25.8625 26.2625 23.7375 40-41 23.549999999999997 26.887499999999996 26.237500000000004 23.325000000000003 42-43 23.5 26.224999999999998 26.650000000000002 23.625 44-45 23.2375 26.7125 26.737499999999997 23.3125 46-47 24.4375 26.275 25.7 23.5875 48-49 23.3375 27.212500000000002 25.912499999999998 23.5375 50-51 23.525 25.874999999999996 25.912499999999998 24.6875 52-53 24.1625 26.237500000000004 25.887500000000003 23.7125 54-55 24.525 26.400000000000002 25.85 23.225 56-57 24.3 26.125 25.874999999999996 23.7 58-59 23.8375 26.5375 25.8 23.825 60-61 23.65 26.05 26.900000000000002 23.400000000000002 62-63 23.4375 25.074999999999996 26.8 24.6875 64-65 23.1875 26.900000000000002 26.187500000000004 23.724999999999998 66-67 24.55 26.3 25.912499999999998 23.2375 68-69 24.525 25.650000000000002 25.825 24.0 70-71 23.474999999999998 26.1 26.5875 23.8375 72-73 23.2125 27.1125 25.55 24.125 74-75 24.0 25.837500000000002 25.474999999999998 24.6875 76-77 24.375 25.1875 26.4625 23.974999999999998 78-79 23.5875 25.4375 26.474999999999998 24.5 80-81 23.962500000000002 26.2875 26.0 23.75 82-83 24.1375 25.224999999999998 26.8375 23.799999999999997 84-85 23.674999999999997 26.187500000000004 24.725 25.412499999999998 86-87 23.70824471412486 26.598273489303143 25.572375828850248 24.121105967721757 88-89 24.024512256128062 26.988494247123562 26.225612806403202 22.761380690345174 90-91 24.159059647367762 26.860072527197698 25.62210829060898 23.35875953482556 92-93 23.9125 26.3125 26.237500000000004 23.5375 94-95 24.4 26.8 25.174999999999997 23.625 96-97 23.474999999999998 26.5 26.987499999999997 23.0375 98-99 24.1375 26.875 25.8125 23.175 100 25.074999999999996 26.275 25.724999999999998 22.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 2.5 27 3.5 28 4.5 29 6.5 30 6.5 31 14.5 32 24.0 33 31.0 34 38.5 35 49.0 36 69.5 37 85.5 38 97.5 39 100.5 40 120.5 41 154.0 42 177.0 43 210.5 44 217.5 45 216.0 46 220.0 47 220.5 48 223.5 49 198.5 50 174.5 51 150.5 52 135.5 53 141.5 54 118.0 55 91.5 56 78.5 57 73.5 58 72.0 59 64.0 60 56.5 61 51.0 62 46.5 63 36.0 64 22.0 65 13.0 66 13.5 67 19.5 68 22.5 69 21.5 70 15.5 71 10.5 72 12.5 73 18.5 74 18.0 75 11.0 76 8.5 77 4.5 78 1.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.08750000000000001 88-89 0.05 90-91 0.0375 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 96.23585153987891 91.4 2 2.8428533824690705 5.4 3 0.5790997630955514 1.6500000000000001 4 0.18425901553040272 0.7000000000000001 5 0.07896814951302975 0.375 6 0.052645433008686494 0.3 7 0.026322716504343247 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 6 0.15 TruSeq Adapter, Index 12 (100% over 50bp) CTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTG 6 0.15 No Hit CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACT 5 0.125 No Hit AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATG 5 0.125 TruSeq Adapter, Index 12 (100% over 49bp) CGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 1.1124999999999998 0.0 0.0 0.0 0.0 88 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra Read 436716 spots for SRR3472999.sra Written 436716 spots for SRR3472999.sra Read 436714 spots for SRR3472999.sra Written 436714 spots for SRR3472999.sra SRR ids: ['SRR3472999.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_svdjoenb SRR3472999.sra spots: 8734282 blocks: [[1, 436714], [436715, 873428], [873429, 1310142], [1310143, 1746856], [1746857, 2183570], [2183571, 2620284], [2620285, 3056998], [3056999, 3493712], [3493713, 3930426], [3930427, 4367140], [4367141, 4803854], [4803855, 5240568], [5240569, 5677282], [5677283, 6113996], [6113997, 6550710], [6550711, 6987424], [6987425, 7424138], [7424139, 7860852], [7860853, 8297566], [8297567, 8734282]] SRR3472999 file size 2382930 SRR3472999 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3472999 SRR3472999_1.fastq Input file: SRR3472999_1.fastq trimmed: SRR3472999-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 23:24:28 2025 >> started Thu Feb 13 23:24:33 2025 >> done (5.096s) 8734282 reads processed; of these: 4232 ( 0.05%) short reads filtered out after trimming by size control 26986 ( 0.31%) empty reads filtered out after trimming by size control 8703064 (99.64%) reads available; of these: 557943 ( 6.41%) trimmed reads available after processing 8145121 (93.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 500 0.01% 19 605 0.01% 20 759 0.01% 21 824 0.01% 22 894 0.01% 23 1070 0.01% 24 1279 0.01% 25 1588 0.02% 26 1543 0.02% 27 1641 0.02% 28 1649 0.02% 29 1876 0.02% 30 1976 0.02% 31 1887 0.02% 32 1902 0.02% 33 1950 0.02% 34 2035 0.02% 35 2100 0.02% 36 2195 0.03% 37 2234 0.03% 38 2514 0.03% 39 2617 0.03% 40 2717 0.03% 41 2768 0.03% 42 2948 0.03% 43 2915 0.03% 44 3081 0.04% 45 2979 0.03% 46 3232 0.04% 47 3316 0.04% 48 3303 0.04% 49 3589 0.04% 50 3458 0.04% 51 3711 0.04% 52 3824 0.04% 53 3725 0.04% 54 3760 0.04% 55 3771 0.04% 56 3928 0.05% 57 4236 0.05% 58 4228 0.05% 59 4242 0.05% 60 4449 0.05% 61 4576 0.05% 62 4721 0.05% 63 5038 0.06% 64 4923 0.06% 65 5029 0.06% 66 4819 0.06% 67 5078 0.06% 68 5317 0.06% 69 4765 0.05% 70 4862 0.06% 71 5001 0.06% 72 4893 0.06% 73 5065 0.06% 74 5291 0.06% 75 5067 0.06% 76 5162 0.06% 77 5587 0.06% 78 5899 0.07% 79 6137 0.07% 80 6448 0.07% 81 7147 0.08% 82 7407 0.09% 83 7822 0.09% 84 8545 0.10% 85 9220 0.11% 86 9689 0.11% 87 10429 0.12% 88 11847 0.14% 89 12626 0.15% 90 14224 0.16% 91 16278 0.19% 92 18920 0.22% 93 21285 0.24% 94 24946 0.29% 95 29044 0.33% 96 33068 0.38% 97 35300 0.41% 98 35310 0.41% 99 31340 0.36% 100 8145121 93.59% 8703064 reads passed initial QC criterion=sequence-density sequence-density=1.31 sequence-density-rank=1 fanout-score=62.49 fanout-score-rank=1 prefix-density=1.83 prefix-fanout=44.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATG criterion=fanout-score sequence-density=1.31 sequence-density-rank=1 fanout-score=62.49 fanout-score-rank=1 prefix-density=1.83 prefix-fanout=44.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATG Started job on | Feb 13 23:24:49 Started mapping on | Feb 13 23:24:49 Finished on | Feb 13 23:25:11 Mapping speed, Million of reads per hour | 1424.14 Number of input reads | 8703064 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 5759818 Uniquely mapped reads % | 66.18% Average mapped length | 98.29 Number of splices: Total | 1680911 Number of splices: Annotated (sjdb) | 1653840 Number of splices: GT/AG | 1651582 Number of splices: GC/AG | 23378 Number of splices: AT/AC | 2122 Number of splices: Non-canonical | 3829 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 1.62 Insertion rate per base | 0.01% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250032 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 2614498 % of reads mapped to too many loci | 30.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.80% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2693214 2693214 2693214 N_multimapping 250032 250032 250032 N_noFeature 202978 3013958 2918586 N_ambiguous 48987 9222 9620 UnstrandedReadsAssigned:5507853 PositiveStrandReadsAssigned:2736638 NegativeStrandReadsAssigned:2831612 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3472999 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3472999-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,703,064 reads, 7,914,901 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR3472999.ke.tsv 34699 SRR3472999.se.tsv 87100 total ==> SRR3472999.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 172 11.8425 Potri.005G024800.1.v4.1 1035 936 88 12.4221 Potri.004G059700.1.v4.1 961 862 23 3.52541 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 211.541 9.82774 Potri.016G087400.1.v4.1 270 171 386 298.25 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 8 0.631428 Potri.012G127500.1.v4.1 977 878 10707 1611.25 ==> SRR3472999.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 174 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3472999 completed mapping pipeline successfully