Starting /dee2/code/volunteer_pipeline.sh SRR3473000 current disk space = 3089046286336 free memory = 1580143476 SRR3473000 SRAfilesize 2c2658d94787e1b00f76415d3b98f0f1 SRR3473000.sra SRR3473000.sra file validated SRR3473000 is single end SRR3473000 is conventional basespace SRR3473000 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473000_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.29475 39.0 38.0 40.0 33.0 40.0 2 37.26325 39.0 38.0 40.0 33.0 40.0 3 37.2345 39.0 38.0 40.0 33.0 40.0 4 37.19325 39.0 38.0 40.0 33.0 40.0 5 37.13375 39.0 38.0 40.0 33.0 40.0 6 37.31575 39.0 38.0 40.0 33.0 40.0 7 37.2545 39.0 38.0 40.0 33.0 40.0 8 37.2315 39.0 38.0 40.0 33.0 40.0 9 37.173 39.0 38.0 40.0 32.0 40.0 10 37.23775 39.0 38.0 40.0 33.0 40.0 11 37.602 39.0 38.0 40.0 33.0 40.0 12 37.4245 39.0 38.0 40.0 33.0 40.0 13 37.3745 39.0 38.0 40.0 33.0 40.0 14 37.20525 39.0 37.0 40.0 32.0 40.0 15 37.2515 39.0 37.0 40.0 33.0 40.0 16 37.1595 39.0 37.0 40.0 33.0 40.0 17 37.30025 39.0 37.0 40.0 33.0 40.0 18 37.112 39.0 36.0 40.0 32.0 40.0 19 37.094 39.0 36.0 40.0 32.0 40.0 20 37.0835 39.0 37.0 40.0 32.0 40.0 21 36.9135 39.0 36.0 40.0 31.0 40.0 22 36.947 39.0 36.0 40.0 31.0 40.0 23 36.85975 39.0 36.0 40.0 31.0 40.0 24 36.7645 39.0 36.0 40.0 31.0 40.0 25 36.65425 39.0 36.0 40.0 31.0 40.0 26 36.642 39.0 36.0 40.0 31.0 40.0 27 36.7615 39.0 36.0 40.0 31.0 40.0 28 36.6895 39.0 36.0 40.0 31.0 40.0 29 36.5675 39.0 36.0 40.0 31.0 40.0 30 36.4425 39.0 36.0 40.0 31.0 40.0 31 36.33125 39.0 36.0 40.0 31.0 40.0 32 36.18825 39.0 35.0 40.0 30.0 40.0 33 35.96625 39.0 35.0 40.0 29.0 40.0 34 36.188 39.0 35.0 40.0 30.0 40.0 35 35.9645 39.0 35.0 40.0 29.0 40.0 36 35.9455 39.0 35.0 40.0 30.0 40.0 37 36.1445 39.0 35.0 40.0 30.0 40.0 38 35.88025 39.0 35.0 40.0 30.0 40.0 39 35.819 39.0 35.0 40.0 29.0 40.0 40 35.80675 39.0 35.0 40.0 29.0 40.0 41 35.57375 38.0 35.0 40.0 29.0 40.0 42 35.36925 38.0 35.0 39.0 29.0 40.0 43 35.27175 38.0 35.0 39.0 28.0 40.0 44 35.42075 38.0 35.0 39.0 29.0 40.0 45 35.0665 38.0 34.0 39.0 28.0 40.0 46 35.18625 38.0 35.0 39.0 29.0 40.0 47 35.07925 38.0 35.0 39.0 29.0 40.0 48 34.71775 38.0 34.0 39.0 27.0 40.0 49 34.6175 38.0 33.0 39.0 27.0 40.0 50 34.80275 38.0 34.0 39.0 27.0 40.0 51 34.77025 38.0 34.0 39.0 28.0 40.0 52 34.265 37.0 33.0 39.0 27.0 40.0 53 34.17275 37.0 33.0 39.0 27.0 40.0 54 34.13175 37.0 33.0 39.0 27.0 40.0 55 34.244 37.0 33.0 39.0 27.0 40.0 56 33.9245 37.0 33.0 39.0 26.0 40.0 57 33.50525 36.0 33.0 39.0 25.0 39.0 58 33.716 37.0 33.0 39.0 26.0 40.0 59 33.45925 36.0 33.0 39.0 25.0 39.0 60 32.8855 36.0 32.0 38.0 23.0 39.0 61 32.9185 36.0 33.0 38.0 23.0 39.0 62 32.7665 36.0 33.0 38.0 23.0 39.0 63 32.63525 36.0 33.0 38.0 23.0 39.0 64 32.3735 36.0 32.0 38.0 23.0 39.0 65 32.108 35.0 32.0 38.0 22.0 39.0 66 31.607 35.0 31.0 38.0 17.0 39.0 67 31.6 35.0 31.0 38.0 16.0 39.0 68 30.91575 35.0 30.0 38.0 15.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 0.0 4 0.0 5 1.0 6 1.0 7 5.0 8 2.0 9 3.0 10 10.0 11 7.0 12 10.0 13 11.0 14 8.0 15 10.0 16 7.0 17 13.0 18 8.0 19 6.0 20 12.0 21 16.0 22 18.0 23 20.0 24 31.0 25 21.0 26 44.0 27 48.0 28 68.0 29 61.0 30 56.0 31 81.0 32 107.0 33 120.0 34 171.0 35 258.0 36 365.0 37 504.0 38 905.0 39 962.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.91743119266055 15.112130479102955 17.686034658511723 41.284403669724774 2 19.2 24.15 36.525 20.125 3 24.099999999999998 27.85 25.75 22.3 4 25.124999999999996 33.475 19.85 21.55 5 24.5 35.675000000000004 23.075000000000003 16.75 6 18.025 37.225 24.55 20.200000000000003 7 16.35 16.85 43.9 22.900000000000002 8 19.475 22.3 29.45 28.775000000000002 9 20.349999999999998 22.8 31.324999999999996 25.525 10 21.349999999999998 36.85 23.225 18.575 11 26.450000000000003 26.724999999999998 19.45 27.375 12 21.725 23.1 27.85 27.325 13 20.225 27.900000000000002 30.825000000000003 21.05 14 20.525 28.449999999999996 29.5 21.525 15 22.725 25.6 28.9 22.775000000000002 16 22.225 27.0 26.5 24.275 17 23.025000000000002 28.749999999999996 26.400000000000002 21.825 18 22.225 27.450000000000003 26.5 23.825 19 23.0 27.3 27.925 21.775 20 22.125 26.55 27.575 23.75 21 21.65 27.900000000000002 26.974999999999998 23.474999999999998 22 20.75 27.6 28.749999999999996 22.900000000000002 23 21.125 29.075 26.55 23.25 24 21.7 28.549999999999997 27.800000000000004 21.95 25 22.0 27.85 27.575 22.575 26 22.025 29.175 26.875 21.925 27 21.725 29.125 27.1 22.05 28 22.95 27.900000000000002 26.450000000000003 22.7 29 21.3 29.299999999999997 27.775 21.625 30 22.475 28.1 27.325 22.1 31 21.725 27.575 27.55 23.150000000000002 32 22.175 28.575 27.025 22.225 33 22.025 27.6 27.275 23.1 34 21.725 27.575 28.575 22.125 35 22.75 28.175 25.924999999999997 23.150000000000002 36 23.0 26.974999999999998 28.325 21.7 37 22.675 28.000000000000004 27.625 21.7 38 22.05 27.825 28.849999999999998 21.275 39 22.5 27.400000000000002 26.3 23.799999999999997 40 22.775000000000002 28.025 25.35 23.849999999999998 41 21.55 29.175 26.724999999999998 22.55 42 21.825 27.200000000000003 28.425 22.55 43 21.95 28.050000000000004 27.1 22.900000000000002 44 21.5 29.075 27.825 21.6 45 22.0 28.225 26.775 23.0 46 22.5 27.500000000000004 27.275 22.725 47 22.475 27.800000000000004 26.825 22.900000000000002 48 21.575 27.375 28.375 22.675 49 22.75 27.175 28.375 21.7 50 21.575 28.125 27.800000000000004 22.5 51 21.75 27.85 28.025 22.375 52 22.475 27.775 26.625 23.125 53 21.975 27.375 27.125 23.525 54 22.425 27.950000000000003 27.700000000000003 21.925 55 23.1 26.75 27.474999999999998 22.675 56 21.099999999999998 27.474999999999998 29.225 22.2 57 22.525000000000002 26.8 28.275 22.400000000000002 58 22.35 28.249999999999996 27.125 22.275 59 23.200000000000003 26.450000000000003 27.55 22.8 60 22.45 27.750000000000004 26.924999999999997 22.875 61 21.325 27.525 28.499999999999996 22.650000000000002 62 23.1 27.400000000000002 27.6 21.9 63 21.825 27.450000000000003 27.725 23.0 64 21.5 27.525 28.15 22.825 65 21.55 28.299999999999997 26.125 24.025 66 22.175 28.449999999999996 27.275 22.1 67 22.05 27.55 27.925 22.475 68 22.425 27.450000000000003 27.650000000000002 22.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.5 21 4.0 22 3.0 23 4.0 24 5.5 25 6.0 26 10.5 27 19.5 28 24.0 29 25.0 30 35.5 31 45.0 32 46.5 33 67.5 34 87.0 35 109.0 36 160.0 37 189.0 38 197.5 39 232.5 40 288.5 41 318.0 42 334.5 43 351.0 44 351.0 45 354.0 46 337.5 47 318.0 48 299.0 49 264.0 50 248.0 51 204.0 52 147.5 53 135.0 54 122.0 55 91.0 56 73.0 57 61.5 58 48.5 59 47.0 60 37.5 61 30.0 62 32.0 63 28.0 64 17.5 65 10.0 66 9.0 67 7.0 68 8.0 69 11.0 70 9.0 71 8.5 72 10.0 73 7.5 74 5.0 75 5.0 76 3.5 77 1.5 78 1.0 79 0.5 80 1.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317994 spots for SRR3473000.sra Written 317994 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra Read 317989 spots for SRR3473000.sra Written 317989 spots for SRR3473000.sra SRR ids: ['SRR3473000.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dxd3wb3v SRR3473000.sra spots: 6359785 blocks: [[1, 317989], [317990, 635978], [635979, 953967], [953968, 1271956], [1271957, 1589945], [1589946, 1907934], [1907935, 2225923], [2225924, 2543912], [2543913, 2861901], [2861902, 3179890], [3179891, 3497879], [3497880, 3815868], [3815869, 4133857], [4133858, 4451846], [4451847, 4769835], [4769836, 5087824], [5087825, 5405813], [5405814, 5723802], [5723803, 6041791], [6041792, 6359785]] SRR3473000 file size 1329136 SRR3473000 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473000 SRR3473000_1.fastq Input file: SRR3473000_1.fastq trimmed: SRR3473000-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 01:01:29 2025 >> started Fri Feb 14 01:01:32 2025 >> done (2.964s) 6359785 reads processed; of these: 21081 ( 0.33%) short reads filtered out after trimming by size control 44751 ( 0.70%) empty reads filtered out after trimming by size control 6293953 (98.96%) reads available; of these: 399716 ( 6.35%) trimmed reads available after processing 5894237 (93.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1599 0.03% 19 2489 0.04% 20 4449 0.07% 21 1306 0.02% 22 1755 0.03% 23 2503 0.04% 24 3846 0.06% 25 7161 0.11% 26 1900 0.03% 27 2118 0.03% 28 2828 0.04% 29 4287 0.07% 30 7072 0.11% 31 2107 0.03% 32 2597 0.04% 33 2848 0.05% 34 4355 0.07% 35 7257 0.12% 36 2087 0.03% 37 2723 0.04% 38 3799 0.06% 39 6003 0.10% 40 11120 0.18% 41 2572 0.04% 42 3320 0.05% 43 4710 0.07% 44 7412 0.12% 45 13081 0.21% 46 3123 0.05% 47 3987 0.06% 48 5720 0.09% 49 9358 0.15% 50 16642 0.26% 51 3934 0.06% 52 5120 0.08% 53 7394 0.12% 54 12215 0.19% 55 23390 0.37% 56 5092 0.08% 57 6772 0.11% 58 10134 0.16% 59 16784 0.27% 60 35422 0.56% 61 6484 0.10% 62 8533 0.14% 63 13029 0.21% 64 22376 0.36% 65 38921 0.62% 66 7432 0.12% 67 18550 0.29% 68 5894237 93.65% 6293953 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=5.84 fanout-score-rank=10 prefix-density=0.14 prefix-fanout=4.5 sequence=CCAACAAAGCAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=15.88 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.7 sequence=CGCATCGCCGGTAGAAGGGACGAGGCGACCGGTGCACACCTGAGGCGGACCGGCCGACCCAACCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACTCGAAGAGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCTCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCAGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCGCGTCGACCTTTTATCTAATAAATGCGTC Started job on | Feb 14 01:01:48 Started mapping on | Feb 14 01:01:48 Finished on | Feb 14 01:01:59 Mapping speed, Million of reads per hour | 2059.84 Number of input reads | 6293953 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4974227 Uniquely mapped reads % | 79.03% Average mapped length | 66.97 Number of splices: Total | 1034103 Number of splices: Annotated (sjdb) | 1019240 Number of splices: GT/AG | 1016661 Number of splices: GC/AG | 14178 Number of splices: AT/AC | 1630 Number of splices: Non-canonical | 1634 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 224661 % of reads mapped to multiple loci | 3.57% Number of reads mapped to too many loci | 475634 % of reads mapped to too many loci | 7.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.84% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1095065 1095065 1095065 N_multimapping 224661 224661 224661 N_noFeature 147578 2540750 2562727 N_ambiguous 32255 7056 6913 UnstrandedReadsAssigned:4794394 PositiveStrandReadsAssigned:2426421 NegativeStrandReadsAssigned:2404587 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3473000 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473000-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,293,953 reads, 5,348,673 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR3473000.ke.tsv 34699 SRR3473000.se.tsv 87100 total ==> SRR3473000.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 418 55.9252 Potri.005G024800.1.v4.1 1035 936 94 25.7845 Potri.004G059700.1.v4.1 961 862 37 11.0205 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 384.721 34.7314 Potri.016G087400.1.v4.1 270 171 110 165.159 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 120.805 18.5283 Potri.012G127500.1.v4.1 977 878 1385 405.006 ==> SRR3473000.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 132 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 63 SRR3473000 completed mapping pipeline successfully