Starting /dee2/code/volunteer_pipeline.sh SRR3473001 current disk space = 3089229721600 free memory = 1402139300 SRR3473001 SRAfilesize 5535873bd9d33f6f4b1927e8f64f870b SRR3473001.sra SRR3473001.sra file validated SRR3473001 is single end SRR3473001 is conventional basespace SRR3473001 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473001_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.30825 39.0 38.0 40.0 33.0 40.0 2 37.194 39.0 38.0 40.0 33.0 40.0 3 37.155 39.0 38.0 40.0 33.0 40.0 4 37.14725 39.0 38.0 40.0 32.0 40.0 5 37.0735 39.0 38.0 40.0 32.0 40.0 6 37.18775 39.0 38.0 40.0 33.0 40.0 7 37.20675 39.0 38.0 40.0 33.0 40.0 8 37.14325 39.0 38.0 40.0 33.0 40.0 9 37.08775 39.0 38.0 40.0 32.0 40.0 10 37.1445 39.0 38.0 40.0 32.0 40.0 11 37.46 39.0 38.0 40.0 33.0 40.0 12 37.372 39.0 38.0 40.0 33.0 40.0 13 37.25 39.0 38.0 40.0 32.0 40.0 14 37.1685 39.0 37.0 40.0 32.0 40.0 15 37.1235 39.0 37.0 40.0 32.0 40.0 16 37.12025 39.0 37.0 40.0 32.0 40.0 17 37.186 39.0 37.0 40.0 32.0 40.0 18 37.0365 39.0 36.0 40.0 31.0 40.0 19 36.98275 39.0 37.0 40.0 31.0 40.0 20 36.82025 39.0 36.0 40.0 31.0 40.0 21 36.80125 39.0 36.0 40.0 31.0 40.0 22 36.87275 39.0 36.0 40.0 31.0 40.0 23 36.681 39.0 36.0 40.0 31.0 40.0 24 36.70375 39.0 36.0 40.0 31.0 40.0 25 36.6145 39.0 36.0 40.0 31.0 40.0 26 36.5075 39.0 36.0 40.0 31.0 40.0 27 36.62425 39.0 36.0 40.0 31.0 40.0 28 36.44825 39.0 36.0 40.0 31.0 40.0 29 36.3895 39.0 36.0 40.0 31.0 40.0 30 36.36175 39.0 36.0 40.0 30.0 40.0 31 36.21975 39.0 36.0 40.0 30.0 40.0 32 35.994 39.0 35.0 40.0 29.0 40.0 33 35.81025 39.0 35.0 40.0 29.0 40.0 34 36.05475 39.0 36.0 40.0 30.0 40.0 35 35.89775 39.0 35.0 40.0 29.0 40.0 36 35.8095 39.0 35.0 40.0 29.0 40.0 37 36.0115 39.0 35.0 40.0 30.0 40.0 38 35.687 39.0 35.0 40.0 29.0 40.0 39 35.68175 39.0 35.0 40.0 29.0 40.0 40 35.53875 39.0 35.0 40.0 29.0 40.0 41 35.393 38.0 35.0 40.0 29.0 40.0 42 35.2055 38.0 35.0 39.0 28.0 40.0 43 35.06775 38.0 34.0 39.0 28.0 40.0 44 35.26225 38.0 35.0 40.0 29.0 40.0 45 34.926 38.0 35.0 39.0 27.0 40.0 46 34.96875 38.0 35.0 39.0 27.0 40.0 47 34.79325 38.0 34.0 39.0 27.0 40.0 48 34.59325 38.0 34.0 39.0 27.0 40.0 49 34.43375 38.0 33.0 39.0 26.0 40.0 50 34.61575 38.0 34.0 39.0 27.0 40.0 51 34.485 38.0 34.0 39.0 26.0 40.0 52 33.96775 37.0 33.0 39.0 25.0 40.0 53 33.91475 37.0 33.0 39.0 25.0 40.0 54 33.883 37.0 33.0 39.0 26.0 40.0 55 33.92525 37.0 33.0 39.0 25.0 40.0 56 33.7695 37.0 33.0 39.0 26.0 40.0 57 33.17175 36.0 33.0 39.0 23.0 39.0 58 33.4595 36.0 33.0 39.0 25.0 40.0 59 33.20875 36.0 33.0 39.0 24.0 39.0 60 32.70825 36.0 33.0 38.0 23.0 39.0 61 32.778 36.0 33.0 38.0 23.0 39.0 62 32.564 36.0 33.0 38.0 22.0 39.0 63 32.552 36.0 33.0 38.0 22.0 39.0 64 32.242 36.0 32.0 38.0 21.0 39.0 65 32.04375 36.0 32.0 38.0 19.0 39.0 66 31.523 35.0 31.0 38.0 2.0 39.0 67 31.46125 35.0 31.0 38.0 2.0 39.0 68 30.78675 35.0 30.0 38.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 3.0 4 1.0 5 0.0 6 2.0 7 4.0 8 4.0 9 4.0 10 9.0 11 7.0 12 10.0 13 9.0 14 11.0 15 6.0 16 13.0 17 15.0 18 16.0 19 7.0 20 14.0 21 14.0 22 21.0 23 32.0 24 25.0 25 29.0 26 43.0 27 49.0 28 54.0 29 85.0 30 57.0 31 75.0 32 95.0 33 128.0 34 177.0 35 212.0 36 310.0 37 538.0 38 887.0 39 1002.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.101349630761394 14.795008912655971 16.781257957728545 42.32238349885409 2 19.5 26.724999999999998 35.35 18.425 3 23.9 29.45 24.975 21.675 4 24.5 34.675 19.950000000000003 20.875 5 24.5 36.0 21.675 17.825 6 17.95 36.275 25.2 20.575 7 16.6 16.2 44.474999999999994 22.725 8 20.599999999999998 21.85 28.1 29.45 9 19.875 22.775000000000002 31.05 26.3 10 19.7 39.375 23.05 17.875 11 26.85 26.375 20.05 26.724999999999998 12 20.125 24.5 29.849999999999998 25.525 13 20.45 27.700000000000003 30.2 21.65 14 21.45 26.8 29.375 22.375 15 20.549999999999997 27.3 28.349999999999998 23.799999999999997 16 21.775 28.075 26.375 23.775 17 22.7 27.474999999999998 28.525 21.3 18 22.325 28.1 27.375 22.2 19 22.075 27.950000000000003 26.825 23.150000000000002 20 21.224999999999998 28.4 27.675 22.7 21 22.2 27.500000000000004 27.200000000000003 23.1 22 22.125 28.125 27.775 21.975 23 21.6 30.175 26.525 21.7 24 21.075 27.975 27.150000000000002 23.799999999999997 25 22.275 26.700000000000003 27.825 23.200000000000003 26 22.525000000000002 27.875 27.0 22.6 27 20.849999999999998 28.799999999999997 27.975 22.375 28 21.75 28.999999999999996 27.35 21.9 29 22.85 27.224999999999998 26.700000000000003 23.225 30 21.75 27.075 28.075 23.1 31 21.575 28.075 27.3 23.05 32 23.225 27.075 28.375 21.325 33 21.675 27.025 27.925 23.375 34 21.099999999999998 29.25 27.625 22.025 35 21.025 28.825 27.375 22.775000000000002 36 21.575 28.475 27.55 22.400000000000002 37 21.875 29.349999999999998 26.724999999999998 22.05 38 22.475 27.55 27.400000000000002 22.575 39 21.4 27.800000000000004 27.975 22.825 40 21.725 28.999999999999996 27.575 21.7 41 22.05 27.775 28.125 22.05 42 21.6 27.55 28.199999999999996 22.650000000000002 43 21.675 27.750000000000004 27.800000000000004 22.775000000000002 44 23.0 28.549999999999997 26.700000000000003 21.75 45 21.525 28.799999999999997 26.85 22.825 46 22.425 28.749999999999996 27.450000000000003 21.375 47 21.9 28.025 27.525 22.55 48 22.125 26.650000000000002 28.499999999999996 22.725 49 22.875 27.650000000000002 27.800000000000004 21.675 50 21.55 27.800000000000004 28.4 22.25 51 21.525 28.549999999999997 27.975 21.95 52 22.225 28.249999999999996 27.6 21.925 53 22.45 27.975 27.425 22.15 54 20.95 28.7 28.025 22.325 55 22.575 27.450000000000003 27.800000000000004 22.175 56 21.7 28.025 28.775000000000002 21.5 57 21.25 28.275 27.85 22.625 58 21.425 27.800000000000004 28.549999999999997 22.225 59 21.6 28.599999999999998 27.175 22.625 60 22.275 27.650000000000002 27.500000000000004 22.575 61 22.3 27.950000000000003 27.6 22.15 62 22.8 27.0 26.825 23.375 63 21.775 28.449999999999996 27.0 22.775000000000002 64 21.224999999999998 27.975 28.4 22.400000000000002 65 21.725 28.000000000000004 28.625 21.65 66 22.85 27.875 26.700000000000003 22.575 67 21.224999999999998 29.599999999999998 26.875 22.3 68 22.900000000000002 28.000000000000004 26.974999999999998 22.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 1.0 21 2.5 22 3.0 23 4.5 24 6.0 25 6.0 26 13.0 27 19.0 28 18.0 29 25.0 30 38.0 31 44.0 32 51.5 33 76.0 34 93.0 35 112.5 36 160.0 37 188.0 38 205.0 39 255.0 40 307.0 41 326.0 42 353.0 43 358.5 44 337.0 45 327.0 46 311.5 47 306.0 48 280.5 49 245.0 50 235.0 51 214.0 52 171.0 53 149.0 54 123.0 55 85.0 56 73.0 57 63.5 58 49.5 59 45.0 60 38.0 61 28.0 62 25.0 63 21.5 64 13.5 65 11.0 66 13.0 67 9.0 68 3.5 69 2.0 70 3.0 71 2.5 72 1.0 73 2.0 74 2.0 75 1.0 76 1.0 77 1.5 78 2.0 79 1.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra Read 333616 spots for SRR3473001.sra Written 333616 spots for SRR3473001.sra Read 333606 spots for SRR3473001.sra Written 333606 spots for SRR3473001.sra SRR ids: ['SRR3473001.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_daz0y9bz SRR3473001.sra spots: 6672130 blocks: [[1, 333606], [333607, 667212], [667213, 1000818], [1000819, 1334424], [1334425, 1668030], [1668031, 2001636], [2001637, 2335242], [2335243, 2668848], [2668849, 3002454], [3002455, 3336060], [3336061, 3669666], [3669667, 4003272], [4003273, 4336878], [4336879, 4670484], [4670485, 5004090], [5004091, 5337696], [5337697, 5671302], [5671303, 6004908], [6004909, 6338514], [6338515, 6672130]] SRR3473001 file size 1394466 SRR3473001 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473001 SRR3473001_1.fastq Input file: SRR3473001_1.fastq trimmed: SRR3473001-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 23:29:24 2025 >> started Thu Feb 13 23:29:28 2025 >> done (3.246s) 6672130 reads processed; of these: 20878 ( 0.31%) short reads filtered out after trimming by size control 47280 ( 0.71%) empty reads filtered out after trimming by size control 6603972 (98.98%) reads available; of these: 385830 ( 5.84%) trimmed reads available after processing 6218142 (94.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1481 0.02% 19 2490 0.04% 20 4539 0.07% 21 1307 0.02% 22 1707 0.03% 23 2411 0.04% 24 3857 0.06% 25 6980 0.11% 26 1949 0.03% 27 2147 0.03% 28 2752 0.04% 29 4105 0.06% 30 6971 0.11% 31 2053 0.03% 32 2412 0.04% 33 2678 0.04% 34 4250 0.06% 35 7211 0.11% 36 2021 0.03% 37 2588 0.04% 38 3641 0.06% 39 5694 0.09% 40 10683 0.16% 41 2431 0.04% 42 3175 0.05% 43 4460 0.07% 44 7210 0.11% 45 12592 0.19% 46 2974 0.05% 47 3756 0.06% 48 5531 0.08% 49 8777 0.13% 50 16183 0.25% 51 3739 0.06% 52 4845 0.07% 53 6918 0.10% 54 11732 0.18% 55 22342 0.34% 56 4899 0.07% 57 6177 0.09% 58 9488 0.14% 59 16222 0.25% 60 34296 0.52% 61 6123 0.09% 62 8139 0.12% 63 12195 0.18% 64 21621 0.33% 65 38857 0.59% 66 7084 0.11% 67 18137 0.27% 68 6218142 94.16% 6603972 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=20 prefix-density=0.15 prefix-fanout=2.0 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=34.17 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=11.1 sequence=TCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCT Started job on | Feb 13 23:29:44 Started mapping on | Feb 13 23:29:44 Finished on | Feb 13 23:29:54 Mapping speed, Million of reads per hour | 2377.43 Number of input reads | 6603972 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 5585275 Uniquely mapped reads % | 84.57% Average mapped length | 66.98 Number of splices: Total | 1145095 Number of splices: Annotated (sjdb) | 1128108 Number of splices: GT/AG | 1125643 Number of splices: GC/AG | 15857 Number of splices: AT/AC | 1747 Number of splices: Non-canonical | 1848 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.78 Insertion rate per base | 0.01% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 246972 % of reads mapped to multiple loci | 3.74% Number of reads mapped to too many loci | 161314 % of reads mapped to too many loci | 2.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.24% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 771725 771725 771725 N_multimapping 246972 246972 246972 N_noFeature 161348 2854417 2870920 N_ambiguous 37800 8410 8149 UnstrandedReadsAssigned:5386127 PositiveStrandReadsAssigned:2722448 NegativeStrandReadsAssigned:2706206 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3473001 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473001-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,603,972 reads, 5,686,147 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR3473001.ke.tsv 34699 SRR3473001.se.tsv 87100 total ==> SRR3473001.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 472 61.2248 Potri.005G024800.1.v4.1 1035 936 79 21.0093 Potri.004G059700.1.v4.1 961 862 35 10.107 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 436.356 38.1919 Potri.016G087400.1.v4.1 270 171 159 231.452 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 119 17.6951 Potri.012G127500.1.v4.1 977 878 1702 482.532 ==> SRR3473001.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 144 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 63 SRR3473001 completed mapping pipeline successfully