Starting /dee2/code/volunteer_pipeline.sh SRR3473002 current disk space = 3089256935424 free memory = 1414902144 SRR3473002 SRAfilesize 9fe55b37b852d6624de2f909873b4fa2 SRR3473002.sra SRR3473002.sra file validated SRR3473002 is single end SRR3473002 is conventional basespace SRR3473002 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473002_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.669 39.0 38.0 40.0 32.0 40.0 2 36.70775 39.0 38.0 40.0 31.0 40.0 3 36.65475 39.0 38.0 40.0 31.0 40.0 4 36.674 39.0 38.0 40.0 31.0 40.0 5 36.60175 39.0 38.0 40.0 31.0 40.0 6 36.917 39.0 38.0 40.0 31.0 40.0 7 36.851 39.0 38.0 40.0 31.0 40.0 8 36.82425 39.0 37.0 40.0 31.0 40.0 9 36.71975 39.0 37.0 40.0 30.0 40.0 10 36.776 39.0 37.0 40.0 31.0 40.0 11 37.322 39.0 38.0 40.0 32.0 40.0 12 37.2015 39.0 37.0 40.0 31.0 40.0 13 37.20875 39.0 37.0 40.0 31.0 40.0 14 37.09775 39.0 36.0 40.0 31.0 40.0 15 37.10175 39.0 36.0 40.0 31.0 40.0 16 36.946 39.0 36.0 40.0 31.0 40.0 17 37.01375 39.0 36.0 40.0 31.0 40.0 18 36.844 39.0 36.0 40.0 31.0 40.0 19 36.7935 39.0 36.0 40.0 31.0 40.0 20 36.63875 39.0 36.0 40.0 31.0 40.0 21 36.5555 39.0 36.0 40.0 31.0 40.0 22 36.63125 39.0 36.0 40.0 31.0 40.0 23 36.5395 39.0 35.0 40.0 31.0 40.0 24 36.53525 39.0 35.0 40.0 31.0 40.0 25 36.38575 39.0 35.0 40.0 31.0 40.0 26 36.27775 39.0 35.0 40.0 30.0 40.0 27 36.40925 39.0 36.0 40.0 31.0 40.0 28 36.35175 39.0 35.0 40.0 31.0 40.0 29 36.23025 39.0 36.0 40.0 30.0 40.0 30 36.056 39.0 35.0 40.0 30.0 40.0 31 35.961 39.0 35.0 40.0 30.0 40.0 32 35.7375 39.0 35.0 40.0 29.0 40.0 33 35.47275 38.0 35.0 40.0 29.0 40.0 34 35.78525 39.0 35.0 40.0 29.0 40.0 35 35.6335 39.0 35.0 40.0 29.0 40.0 36 35.56075 39.0 35.0 40.0 29.0 40.0 37 35.68875 39.0 35.0 40.0 29.0 40.0 38 35.447 38.0 35.0 40.0 29.0 40.0 39 35.3405 38.0 35.0 40.0 29.0 40.0 40 35.2845 38.0 34.0 40.0 28.0 40.0 41 35.19125 38.0 34.0 39.0 29.0 40.0 42 34.88325 38.0 34.0 39.0 28.0 40.0 43 34.85375 38.0 34.0 39.0 28.0 40.0 44 35.00575 38.0 34.0 39.0 29.0 40.0 45 34.5445 38.0 33.0 39.0 27.0 40.0 46 34.56175 38.0 34.0 39.0 27.0 40.0 47 34.41725 38.0 33.0 39.0 27.0 40.0 48 34.09225 37.0 33.0 39.0 26.0 40.0 49 33.9425 37.0 33.0 39.0 25.0 40.0 50 34.152 37.0 33.0 39.0 27.0 40.0 51 34.0025 37.0 33.0 39.0 26.0 40.0 52 33.5515 36.0 33.0 39.0 24.0 40.0 53 33.5615 36.0 33.0 39.0 25.0 40.0 54 33.394 36.0 33.0 39.0 25.0 39.0 55 33.6145 36.0 33.0 39.0 25.0 40.0 56 33.19325 36.0 33.0 39.0 24.0 39.0 57 32.663 36.0 32.0 38.0 23.0 39.0 58 32.91325 36.0 32.0 39.0 23.0 39.0 59 32.66725 36.0 32.0 38.0 22.0 39.0 60 32.112 36.0 31.0 38.0 21.0 39.0 61 31.98175 36.0 32.0 38.0 18.0 39.0 62 31.983 36.0 31.0 38.0 19.0 39.0 63 31.788 35.0 31.0 38.0 18.0 39.0 64 31.57475 35.0 31.0 38.0 17.0 39.0 65 31.26325 35.0 31.0 38.0 14.0 39.0 66 30.8205 35.0 31.0 38.0 2.0 39.0 67 30.89775 35.0 31.0 38.0 2.0 39.0 68 30.15575 34.0 29.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 0.0 4 0.0 5 0.0 6 2.0 7 4.0 8 2.0 9 6.0 10 8.0 11 9.0 12 16.0 13 12.0 14 14.0 15 16.0 16 15.0 17 9.0 18 22.0 19 6.0 20 12.0 21 24.0 22 24.0 23 24.0 24 29.0 25 49.0 26 41.0 27 49.0 28 90.0 29 75.0 30 62.0 31 82.0 32 97.0 33 137.0 34 181.0 35 238.0 36 377.0 37 544.0 38 878.0 39 819.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.6699456381051 14.056432824229873 18.534817499352833 42.738804038312196 2 19.75 24.575 36.5 19.175 3 23.525 28.875 25.974999999999998 21.625 4 24.825 33.050000000000004 20.474999999999998 21.65 5 24.425 34.599999999999994 23.925 17.05 6 18.875 36.825 24.4 19.900000000000002 7 17.5 15.9 45.225 21.375 8 20.549999999999997 22.525000000000002 28.549999999999997 28.375 9 19.325 23.400000000000002 32.574999999999996 24.7 10 20.775 37.8 23.125 18.3 11 26.375 26.724999999999998 20.65 26.25 12 21.25 23.549999999999997 29.325000000000003 25.874999999999996 13 20.825 27.125 31.474999999999998 20.575 14 21.349999999999998 26.6 28.349999999999998 23.7 15 21.725 26.950000000000003 27.650000000000002 23.674999999999997 16 21.099999999999998 27.925 28.525 22.45 17 21.625 27.224999999999998 27.85 23.3 18 22.525000000000002 27.750000000000004 27.075 22.650000000000002 19 21.325 28.625 28.475 21.575 20 22.675 28.499999999999996 27.6 21.224999999999998 21 21.75 27.35 28.125 22.775000000000002 22 20.925 28.725 27.950000000000003 22.400000000000002 23 22.1 28.4 27.525 21.975 24 21.5 29.925 27.400000000000002 21.175 25 22.05 28.000000000000004 28.025 21.925 26 22.15 28.125 26.700000000000003 23.025000000000002 27 21.625 29.425 27.025 21.925 28 21.25 27.325 28.125 23.3 29 21.875 26.924999999999997 27.725 23.474999999999998 30 21.25 28.449999999999996 26.75 23.549999999999997 31 21.349999999999998 27.675 29.225 21.75 32 21.95 27.85 27.650000000000002 22.55 33 21.95 28.525 27.3 22.225 34 20.549999999999997 27.85 28.1 23.5 35 21.875 27.775 26.875 23.474999999999998 36 22.25 28.1 26.8 22.85 37 22.225 28.449999999999996 26.474999999999998 22.85 38 21.45 27.125 26.924999999999997 24.5 39 20.1 28.349999999999998 29.025000000000002 22.525000000000002 40 21.575 27.400000000000002 27.675 23.35 41 21.625 27.675 27.85 22.85 42 22.225 27.525 26.85 23.400000000000002 43 21.05 27.474999999999998 27.625 23.849999999999998 44 21.625 27.675 27.85 22.85 45 22.7 26.75 27.450000000000003 23.1 46 21.45 28.275 27.800000000000004 22.475 47 22.15 27.474999999999998 27.0 23.375 48 21.349999999999998 28.799999999999997 28.1 21.75 49 22.6 28.275 27.200000000000003 21.925 50 22.875 27.375 26.525 23.225 51 21.45 27.1 28.299999999999997 23.150000000000002 52 21.8 27.35 28.075 22.775000000000002 53 21.975 27.325 27.975 22.725 54 22.975 26.724999999999998 28.575 21.725 55 21.075 27.675 28.975 22.275 56 22.325 28.175 28.15 21.349999999999998 57 21.45 27.825 27.6 23.125 58 21.925 27.200000000000003 27.825 23.05 59 21.675 28.825 27.325 22.175 60 22.5 28.4 27.500000000000004 21.6 61 21.775 27.35 28.65 22.225 62 22.2 27.525 28.000000000000004 22.275 63 22.225 27.825 27.450000000000003 22.5 64 21.375 28.7 26.55 23.375 65 22.05 27.900000000000002 27.800000000000004 22.25 66 22.125 26.85 28.025 23.0 67 22.7 27.650000000000002 27.775 21.875 68 21.475 29.549999999999997 27.625 21.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 2.0 21 3.5 22 4.0 23 3.0 24 4.5 25 7.0 26 10.5 27 19.0 28 24.0 29 27.0 30 37.5 31 45.0 32 56.0 33 75.5 34 84.0 35 112.5 36 152.0 37 163.0 38 202.5 39 260.5 40 286.5 41 294.0 42 336.0 43 362.0 44 346.0 45 354.5 46 326.0 47 289.0 48 284.0 49 256.0 50 233.0 51 199.0 52 159.5 53 154.0 54 130.5 55 90.5 56 74.0 57 65.0 58 52.0 59 48.0 60 36.0 61 23.0 62 22.0 63 17.0 64 11.0 65 9.0 66 8.0 67 7.0 68 3.5 69 1.0 70 2.0 71 4.5 72 6.0 73 6.5 74 5.5 75 4.0 76 2.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.899849774662 99.75 2 0.07511266900350526 0.15 3 0.0 0.0 4 0.025037556334501748 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590382 spots for SRR3473002.sra Written 590382 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra Read 590375 spots for SRR3473002.sra Written 590375 spots for SRR3473002.sra SRR ids: ['SRR3473002.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pah_kav7 SRR3473002.sra spots: 11807507 blocks: [[1, 590375], [590376, 1180750], [1180751, 1771125], [1771126, 2361500], [2361501, 2951875], [2951876, 3542250], [3542251, 4132625], [4132626, 4723000], [4723001, 5313375], [5313376, 5903750], [5903751, 6494125], [6494126, 7084500], [7084501, 7674875], [7674876, 8265250], [8265251, 8855625], [8855626, 9446000], [9446001, 10036375], [10036376, 10626750], [10626751, 11217125], [11217126, 11807507]] SRR3473002 file size 2470357 SRR3473002 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473002 SRR3473002_1.fastq Input file: SRR3473002_1.fastq trimmed: SRR3473002-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 23:16:54 2025 >> started Thu Feb 13 23:17:03 2025 >> done (9.295s) 11807507 reads processed; of these: 36724 ( 0.31%) short reads filtered out after trimming by size control 84025 ( 0.71%) empty reads filtered out after trimming by size control 11686758 (98.98%) reads available; of these: 675191 ( 5.78%) trimmed reads available after processing 11011567 (94.22%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2638 0.02% 19 4217 0.04% 20 7596 0.06% 21 2288 0.02% 22 2906 0.02% 23 4217 0.04% 24 6657 0.06% 25 12223 0.10% 26 3392 0.03% 27 3579 0.03% 28 4733 0.04% 29 7116 0.06% 30 12013 0.10% 31 3466 0.03% 32 4254 0.04% 33 4741 0.04% 34 7323 0.06% 35 12423 0.11% 36 3680 0.03% 37 4395 0.04% 38 6124 0.05% 39 9929 0.08% 40 18661 0.16% 41 4285 0.04% 42 5408 0.05% 43 7669 0.07% 44 12587 0.11% 45 21949 0.19% 46 5132 0.04% 47 6542 0.06% 48 9384 0.08% 49 15321 0.13% 50 28498 0.24% 51 6506 0.06% 52 8469 0.07% 53 12267 0.10% 54 20536 0.18% 55 39657 0.34% 56 8254 0.07% 57 11155 0.10% 58 16651 0.14% 59 28286 0.24% 60 60807 0.52% 61 10761 0.09% 62 14385 0.12% 63 21591 0.18% 64 37831 0.32% 65 67777 0.58% 66 12421 0.11% 67 32491 0.28% 68 11011567 94.22% 11686758 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=23 prefix-density=0.12 prefix-fanout=2.0 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=178.47 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=8.0 sequence=CCACCACCAACGCACCCTTACAAGTACAAGTC Started job on | Feb 13 23:17:24 Started mapping on | Feb 13 23:17:25 Finished on | Feb 13 23:17:45 Mapping speed, Million of reads per hour | 2103.62 Number of input reads | 11686758 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 10139484 Uniquely mapped reads % | 86.76% Average mapped length | 67.00 Number of splices: Total | 2039221 Number of splices: Annotated (sjdb) | 2009059 Number of splices: GT/AG | 2005333 Number of splices: GC/AG | 27555 Number of splices: AT/AC | 3112 Number of splices: Non-canonical | 3221 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.79 Insertion rate per base | 0.01% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 474425 % of reads mapped to multiple loci | 4.06% Number of reads mapped to too many loci | 404044 % of reads mapped to too many loci | 3.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.72% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1072849 1072849 1072849 N_multimapping 474425 474425 474425 N_noFeature 310472 5196130 5216961 N_ambiguous 67219 15347 15120 UnstrandedReadsAssigned:9761793 PositiveStrandReadsAssigned:4928007 NegativeStrandReadsAssigned:4907403 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3473002 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473002-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,686,758 reads, 10,433,590 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR3473002.ke.tsv 34699 SRR3473002.se.tsv 87100 total ==> SRR3473002.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1125 78.3919 Potri.005G024800.1.v4.1 1035 936 174 24.858 Potri.004G059700.1.v4.1 961 862 81 12.5653 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 672.58 31.6234 Potri.016G087400.1.v4.1 270 171 319 249.453 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 130.91 10.4571 Potri.012G127500.1.v4.1 977 878 3589 546.604 ==> SRR3473002.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 199 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 188 SRR3473002 completed mapping pipeline successfully